... [], the authors considered the heat source as a function of both space and time variables, in the additive or separable forms Many researchers viewed the source as a function of space or time ... pollution source of a 1D parabolic equation from the initial and the final data The problem is ill posed and regularization is in order Using the quasi-boundary method and the truncation Fourier ... method of a fundamental solution Many authors considered the uniqueness and stability conditions of the determination of the heat source under this separate form In spite of the uniqueness and stability
Ngày tải lên: 16/12/2017, 03:46
... (m&phase<0)is assumed Where m&phase is mass transfer: for evaporation (m&phase=m&evap) and for condensation (m&phase=m&cond) (kg/s) So that the mass balance equations for both phases are; ... performance and design of air-breathing PEM fuel cells Litster and Djilali [1] developed a single-phase one-dimensional semi-analytical model of the membrane electrode assembly (MEA) of planar air-breathing ... have generally relied on traditional planar MEA architecture Because the majority of PEM fuel cell designs are based on planar plate and frame architecture, their volumetric power densities are
Ngày tải lên: 05/09/2013, 14:58
A study of linguistic devices to attribute source of information in news reports english vs vietnamese
... newspaper language 2 2 THEORETICAL BACKGROUND 2.2.1 Overview of Appraisal Theory The Appraisal framework is an extension of the linguistic theories of Halliday and his colleagues The Appraisal ... say Francis Bacon was the author of The Tempest Perhaps, Francis Bacon was the author of The Tempest It seems Francis Bacon was the author of The Tempest I contend that Francis Bacon was the author ... Vietnamnet, and The Cong An Nhan Dan 3.3 METHOD OF ANALYSIS Data were analyzed along the dimensions of syntax, semantics, and pragmatics Within these domains, reportive markers in newspapers
Ngày tải lên: 26/11/2013, 13:24
báo cáo hóa học: " The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer''''s disease" ppt
... Shimohama S, Tanino H, Kawakami N, Okamura N, Kodama H, Yamaguchi T, Hayakawa T, Nunomura A, Chiba S, Perry G, Smith MA, Fujimoto S: Activation of NADPH oxidase in Alzheimer's disease brains Biochem ... impairment and profound neuronal loss The neuropathological hallmarks of AD are the senile plaques consisting of extracellular deposits of fibrillar β-amyloid (fAβ) and the intracellular neurofibrillary ... upstream effectors know as GEFs which facilitate the exchange of GDP for GTP and increase the amount of active Rac Page of 12 (page number not for citation purposes) Journal of Neuroinflammation
Ngày tải lên: 19/06/2014, 22:20
Báo cáo hóa học: " Ball Lightning–Aerosol Electrochemical Power Source or A Cloud of Batteries" docx
... form of nanocap-sules (Fig.2) Although such separate particles-nanobatteries are capable of generating only a standard voltage of tenths of a volt to a few volts, the super-sparkover electrostatic ... electroconductivity of nanoparticles, for example due to an initial surface hydration or surface carbonization of nanoparticles An alternative additional condition to facilitate the ini-tiation of the breakdown ... external surface Thus, each separate battery-nanocapsule of this aerosol electrochemical generator contains the black carbon nanoparticle as the core carbon anode, while external sur-faces of molten
Ngày tải lên: 22/06/2014, 18:20
Báo cáo y học: "Human palatine tonsil: a new potential tissue source of multipotent mesenchymal progenitor cells" pdf
... genes Antisense: CTGCAAATGAGACACTTTCTC Antisense: CTGCAGTAGCTGCACGTGTT Cartilage-specific genes Antisense: CACGATGCCTTTCACCACGAC Antisense: TCACCAGGTTCACCAGGATTGC AGN, aggrecan; ALP, alkaline ... Baksh1, Kiran Gollapudi1,3, Drago Prgomet2, Lars Rackwitz1, Arjun S Joshi4 and Rocky S Tuan1 1 Cartilage Biology and Orthopaedics Branch, National Institute of Arthritis and Musculoskeletal and ... differentiation-specific gene expression analysis Housekeeping gene Antisense: TCAGGGATGACCTTGCCCACA Bone-specific genes Antisense: ATCTCGTTGTCTGAGTACCAGTCC Antisense: GCCGTAGAAGCGCCGATAGGC Adipose-specific
Ngày tải lên: 09/08/2014, 10:23
báo cáo khoa học: " Uncharacterized conserved motifs outside the HD-Zip domain in HD-Zip subfamily I transcription factors; a potential source of functional diversity" docx
... diversity Agustín L Arce, Jesica Raineri, Matías Capella, Julieta V Cabello, Raquel L Chan* Abstract Background: Plant HD-Zip transcription factors are modular proteins in which a homeodomain is associated ... transgenic plants with clearly different phenotypes Aiming to elucidate the structural mechanisms underlying such observation and taking advantage of the increasing information in databases of ... presented a clear increase in serration while the rest of the lines had a serration similar to that of WT plants (Figure 8) The quantifications were subjected to the Kruskal-Wallis one-way analysis of
Ngày tải lên: 11/08/2014, 11:21
Báo cáo sinh học: " Exact distribution of a pattern in a set of random sequences generated by a Markov source: applications to biological data" pdf
... 3.56 × 10 -222 Nuel et al. Algorithms for Molecular Biology 2010, 5:15 http://www.almob.org/content/5/1/15 Page 10 of 18 [...]... 10-1 AAAAAAAAAAAAAAAAAAAAAAAA TAWWWWTAGM* YCCNYTNRRCCGN* GCGCNNNNNNGCGC ... significant (e.g., TF AAGAAAAA with a P-value of 1.31 × 10-99)... cumulants (the first two cumulants are the expectation and the variance) of a sum of independent variables are the sum of ... exact value: e. g., Pattern ODZR has an exact P-value of 5.78 × 10 -5 and an approximate one of 2.81 × 10 -4 ; Pattern BZOU has an exact P-value of 2.56 × 10 -11 and an approximate one of 4.49
Ngày tải lên: 12/08/2014, 17:20
Jatropha curcas oil: A future source of biodiesel
... requirement (MMT) Area requirement (Mha) Trang 7Land area under cultivation of jatropha in various statesTrang 8JATROPHA PLANTATIONTrang 9Productivity of Jatropha plantationS.No Seeds/ hactare (MT) ... barren lands under forest & non forest use, dry and drought prone area, marginal lands even an alkaline soils & also as agro forestry crops. Jatropha removes carbon from the atmosphere ... the woody tissues & assists in the build up of soil carbon. Various parts of the plant are of medicinal value. Trang 6Biodiesel and land requirement in IndiaYear Diesel demand (MT) Biodiesel
Ngày tải lên: 13/08/2014, 14:41
Báo cáo y học: "Pathways to child and adolescent psychiatric clinics: a multilevel study of the significance of ethnicity and neighbourhood social characteristics on source of referral" pptx
... available health care options A study by Lindsey et al [20] found that having a large social net-work was associated with the utilisation of school men-tal health services among African American adolescents ... referral may be interpreted as indicating the parents’ recognition and acceptance of the child’s pro-blem and of the fact that the propro-blem warrants mental health care, and also that the parents ... Social norms relating to which behaviours are viewed as undesirable and deviant may also influence referral pat-terns to mental health care, i.e the behaviours that are viewed as acceptable and
Ngày tải lên: 13/08/2014, 18:21
Báo cáo y học: "A hidden reservoir of integrative elements is the major source of recently acquired foreign genes and ORFans in archaeal and bacterial genomes" pdf
... complete viral genome database available at NCBI (as for January 2009; viral data-base) (Figure 4a, b), and with the complete plasmid genome database at NCBI (as for January 2009; plasmid database) ... of foreign genes in bacterial and archaeal genomes and in the origin of ORFans We have developed an accurate and statis-tically validated MM-based strategy to search 119 archaeal and bacterial ... local database containing all ORFs from anno-tated IEs (annoanno-tated IE database) with a local database con-taining all our species-specific core genes from all genomes analyzed (core database),
Ngày tải lên: 14/08/2014, 21:20
examining linguistic ambiguity as a source of constructing funniness in english verbal jockes = khảo sát hiện tượng mơ hồ ngôn ngữ với vai trò là một nguồn tạo nên tính hài hước của các câu chuyện tếu tiếng anh
... information among participants but also to create rapport and personal attitudes of each participant in the communicative event, which is called the transactional and interactional functions of language ... paraphrasing, Hurford and Heasley (2001) assert that a word or sentence is considered ambiguous if and only if it has at least two paraphrases that are not themselves paraphrases of one another A ... means? The war is less than a weak old, and already they have an American-style democracy (p.17) This is a very good case in point of satire as it both exaggerates the degree of corruption and
Ngày tải lên: 02/03/2015, 14:32
Fusing indigenous knowledge and global best practices leads a way to global competitiveness in emerging economies source of china s conspicuous strength in solar and wind industry
... endogenous capability and transitioning from agglomeration stage to local innovation stage Agglomeration and clustering create dense networks that can facilitate assimilation capability through labor ... its market share A large literature has also dealt with the advantages of bringing a product to market fast (Choperena 1996; Griffin 1997; Kessler and Chakrabarti 1996) Greater speed is claimed ... Chihiro Watanabe His invaluable experience and expertise in a broad range of topics especially in the area of technology policy, patents, quantitative research method and technology management has
Ngày tải lên: 08/09/2015, 22:11
Development of a subcortical emphasized physical human head model for evaluation of deep brain source contribution to scalp EEG
... 3.1 Materials of the Physical Head Model 17 3.1.1 Sample preparation of the artificial brain 17 3.1.2 Sample preparation of the artificial skull 18 3.1.3 Sample preparation of the artificial ... Investigate the electrical characteristics of the artificial brain, skull and scalp materials (2) Evaluate the reliability of using a human head phantom system for EEG studies (3) Evaluate the capability ... models, human cadavers and artificial physical phantoms Trang 27Computer simulation such as Finite Element Analysis (FEA) which is often used for the evaluation of the accuracies of EEG localization
Ngày tải lên: 09/09/2015, 10:02
The food you eat is a source of nutrients
... milk, and yogurt Candy, soda, and jelly • These simple carbohydrates have a bad reputation because they are high in calories and low in nutritional value. Trang 8Starches or Complex Carbohydrates ... There are 20 amino acids. Trang 11Of the 20 amino acids, the human body is capable of producing 11 of them The other 9 called, “Essential Amino Acids” must be supplied by food sources. Amino Acids ... growth and healthy skin. Enhance the taste and texture of food. Required to carry “fat-soluble” vitamins throughout the body. Trang 13Types of Fat Saturated Fat: Fats that are usually solid
Ngày tải lên: 30/11/2016, 14:30
The food you eat is a source of nutrients
... milk, and yogurt Candy, soda, and jelly • These simple carbohydrates have a bad reputation because they are high in calories and low in nutritional value. Trang 8Starches or Complex Carbohydrates ... There are 20 amino acids. Trang 11Of the 20 amino acids, the human body is capable of producing 11 of them The other 9 called, “Essential Amino Acids” must be supplied by food sources. Amino Acids ... growth and healthy skin. Enhance the taste and texture of food. Required to carry “fat-soluble” vitamins throughout the body. Trang 13Types of Fat Saturated Fat: Fats that are usually solid
Ngày tải lên: 06/12/2016, 00:53
DSpace at VNU: HOLDER-TYPE APPROXIMATION FOR THE SPATIAL SOURCE TERM OF A BACKWARD HEAT EQUATION
... HÖLDER-TYPE APPROXIMATION FOR THE SPATIAL SOURCE TERM OF A BACKWARD HEAT EQUATION Dang Duc Trong, 1 Mach Nguyet Minh, 2 Pham Ngoc Dinh Alain, 3 and Phan Thanh Nam 4 1Faculty of Mathematics, Vietnam National ... Nguyet Minh , Pham Ngoc Dinh Alain & Phan Thanh Nam (2010) Hölder-Type Approximation for the Spatial Source Term of a Backward Heat Equation, Numerical Functional Analysis and Optimization,31:12, ... determining a spacewise dependent heat source and the initial temperature Applicable Analysis 87:265–276. 10 F Genga and Y Lin (to appear) Application of the variational iteration method to inverse heat
Ngày tải lên: 16/12/2017, 06:24
DSpace at VNU: Open dumping site in Asian developing countries: A potential source of polychlorinated dibenzo-p-dioxins and polychlorinated dibenzofurans
... Tarumi 3-5-7, Matsuyama 790-8566, Japan, Research Center for Material Cycles and Waste Management, National Institute for Environmental Studies, Tsukuba, Japan, Centre of Advanced Study in Marine ... Cambodia, India, and Vietnam, and concentrations of PCDDs and related compounds such as PCDFs and coplanar polychlorinated biphenyls (PCBs) were measured Soils from agricultural and urban areas, ... human health, wildlife, and environmental quality (9) Uncontrolled burning of solid waste by waste pickers, generation of methane gas, lack of advanced waste incineration technology, and natural
Ngày tải lên: 16/12/2017, 10:39
Brown algae as a source of bioactive compounds for pancreatic cancer treatment
... based on size; macro-algae and micro-algae (Bocanegra et al., 2009) Micro-algae are microscopic organisms and include blue-green algae (Cyanobateria), diatoms (Bacillariophyta) and dinoflagellates ... antioxidant activity of these extracts was also found to be greater than conventional hot water extraction of the same material (Li et al., 2013) The advantages and drawbacks of UAE from plants have ... signatories above that it represents a substantial amount of research work and can be part of Thanh Trung Dang’ s PhD thesis Professor Frances Martin Assistant Dean Research Training (ADRT) Date: Trang
Ngày tải lên: 12/12/2018, 23:46
Tài liệu AMAZONIAN ACCESSIONS OF WILD HEVEA GERMPLASM - A POTENTIAL SOURCE OF DROUGHT TOLERANCE pptx
... -100 3 Acre : Brasileia, Feijo, Sena Madureira, Tarauaca, Xapuri Rondonia – Ariquemes, Calama, Costa Marques, Jiparana, Ouro Preto, Pimenta Bueno, Jaru Mato Grosso: Aracotuba, Cartriquaca, Itauba, ... - rainfall pattern limited only to four months in a year - average annual rain fall of 7.5mm per day - average of 90 rainy days/ year. 1 A mature rubber plantation Amazonian accessions of wild ... Hevea germplasm – A potential source of drought tolerance M. A. Mercy, D.B. Nair, Meena Singh, T. Meenakumari, C.P. Reghu and Kavitha K. Mydin Rubber Research Institute of India, Kottayam –...
Ngày tải lên: 21/02/2014, 04:20
Bạn có muốn tìm thêm với từ khóa: