... For Margaret and Meg CONTENTS Introduction Chapter One ∼ Distrust of Wall Street in the 19 20s 11 Chapter Two ∼ The Assault on Wall Street 59 Chapter Three ∼ Continuing the Assault Chapter Four ... interest under which they are exercising that power with constantly increasing effectiveness They are acting, with rare exceptions, strictly within their legal rights but the results are none the ... most contentious, at least to the banks themselves Any institution that accepted deposits from customers was not permitted to underwrite corporate stocks or bonds The securities markets were considered...
Ngày tải lên: 23/04/2014, 16:26
... former, they explained that they wished to work with students of better proficiency, which helps them a lot in their studying The latter meant that the gender was an important factor to the students, ... effective way Therefore, teachers should find out more about their students’ interest in order to know what their favorite activities are From that, teachers can select appropriate activities for ... CHAPTER 3: METHODOLOGY This chapter gives a thorough description of how the research was carried out The first part is the description of the research context The second part looks at the sample...
Ngày tải lên: 07/11/2012, 14:50
Tài liệu Windows and How to Work Them phần 1 ppt
... quick way to restore the Sidebar to its factory settings If you choose Finder Preferences, and then click the Sidebar button, you discover the checkboxes shown here They let you put back the ... drag icons onto Sidebar icons, exactly as though they were the real disks, folders, and programs that they represent It simplifies connecting to networked disks Park your other computers' hard ... programs and documents • It's better than the Dock.In some ways, the Sidebar is a lot like the Dock, in that you can stash favorite icons there of any sort But the Sidebar reveals the names of these...
Ngày tải lên: 21/01/2014, 04:20
Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf
... seen in the crystal structure of human eRF1 [19 ] still remained undetermined in the structure of the eRF1–eRF3 complex [20] We report here the high-resolution NMR structure of the human C- domain ... efficiency of stop codon recognition in a context-dependent manner Discussion Comparison with crystal structure of human eRF1 The two reported crystal structures of human eRF1 (the protein itself, ... protein conformers The main structural difference between the two protein conformers is in the orientation of a3 (residues 348–356), with respect to the b-structure of the minidomain and the corresponding...
Ngày tải lên: 06/03/2014, 11:20
The Finite Element Method Fifth edition Volume 1: The Basis Professor O.C. Zienkiewicz, CBE, FRS ppt
... support during the preparation process Contents Preface xv Some 1. 1 1. 2 1. 3 1. 4 1. 5 1. 6 1. 7 1. 8 preliminaries: the standard discrete system Introduction The structural element and the structural ... system Assembly and analysis of a structure The boundary conditions Electrical and ¯uid networks The general pattern The standard discrete system Transformation of coordinates References A direct ... Generation of incompatible shape functions which satisfy the patch test 10 .10 The weak patch test ± example 10 .11 Higher order patch test ± assessment of robustness 10 .12 Conclusion References 11 ...
Ngày tải lên: 14/03/2014, 15:20
C#1 introduction to programming and the c language potx
... free eBooks at bookboon.com C# Introduction to programming and the C# language Contents Contents Foreword 11 Part Introduction to C# 13 Introduction 14 Hello World 14 Basic program architecture ... which is explained later A value of a string can start with a @ character, that means that escape characters are not interpreted Escape characters are characters in a string that has a special ... program calculates the total price excl VAT, VAT, total price incl VAT and writes the result on the screen If you run the program, the result could be the following: How to he starting point...
Ngày tải lên: 18/03/2014, 02:20
Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot
... structures of the complex between EW29Ch and lactose or N-acetylgalactosamine (PDB: 2ZQN or 2ZQO) reported recently indicate that the overall structure of EW29Ch resembles the characteristic ... using NMR titration experiments From the theoretical calculations of Kd for the ratios of sugar-free to sugarbound peak intensities as a function of sugar concentration, the protein concentration ... artifact caused by the crystallization of lactose-liganded EW29Ch because: (a) in the other EW29Ch molecule of the crystal structure (each crystal contained two molecules A and B) the interaction...
Ngày tải lên: 23/03/2014, 04:21
Báo cáo khoa học: The C-terminus of viral vascular endothelial growth factor-E partially blocks binding to VEGF receptor-1 docx
... from pAPEX–mVEGF-A [15 ] with the following primers: mV-for 5¢ (5¢-CATGGCGCGCCTGATGAAC TTTCTGCTGTCTTGG-3¢) and mV-NZ 2C 3¢ (5¢-CTGAC GCGTGCGGCGTCTTCTGGGCGGCCTTGTGGTCGT CGGTGGCGTGGTTGTGAACTTTGGTCTGCATTCA ... suggests it is well placed to influence the receptor-recognition profile of viral VEGF The C- terminal residues may therefore form a direct physical block, preventing access of the VEGFRs to the receptor-binding ... into inserts with various concentrations of purified growth factor in the bottom compartment and then incubated for h at 37 C Nonmigrated cells were removed from the upper side of the filter membrane...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf
... sequences within either the propeptide or the CT-peptide are able to closely interact with the catalytic and ⁄ or the P-domain at sites remote from the active site although they remain at the moment ... active PC1 ⁄ Another important feature of an enzymatic activator is that it should not be transformed during the reaction In the case of the PC1 ⁄ propeptide, which is implicated in active-site ... secretory granules, it is cleaved in the early secretory compartments However, it remains associated with the mature enzyme until both reach the secretory granules compartments in order to inhibit...
Ngày tải lên: 30/03/2014, 08:20
Báo cáo khoa học: The C-terminal region of CHD3/ZFH interacts with the CIDD region of the Ets transcription factor ERM and represses transcription of the human presenilin 1 gene pot
... GATCGAATTCCTCACCCCACACCGGCCTAC, GATCGAATTCCCTACGCTACACCTCCG, GATCGAATTCTGGCCGCCGCAGGC, GATCGTCGACTCATGCAGGCATCTGGCTGTAATTG GATCGTCGACTCAGCTGCGCTCGGACATCTGAAGGC GATCGTCGACTCATATTCGGGACAGCGTGGCTG GATCGTCGACTCACGCCTTCATGTCGCTCAGCAAC ... GATCGGATCCACTTTGCCTTCCAGTCTCTCAG GATCGAATTCTTTGTCTGTGACCCAGATGC GATCGGATCCTTAGAGGGCATCTGGGTCACAG GATCGGATCCACTCCGCCACTCAGAAACTTAG GATCGAATTCTCACCCACCCATCAGAATC GATCGAATTCCCCCTGCAGATGCCAAAGATG GATCGAATTCGAAGTGCCTAACTGC ... GATCGGATCCTCAATTATCTCCAGGAAC GATCGGATCCTCACTGAAATCTCTGTTC GATCGGATCCTCACTGATGTGGTGGTC GATCGCTAGCGTGTGATGAAGGCGCTAGGGCTTCTGGGT GATCCGGCCGTCATGTGAAGCCACCAT GATCGCTAGCGTGTGATGAAGGCGGAGGCCTTGAATTCACG...
Ngày tải lên: 30/03/2014, 09:20
Chapter 1 Introduction to the C Language
... 20 Primitive Data Types 21 The basic variable naming rules – The first character of a variable name must be either a letter, _ or @ – Subsequent characters may be letters, underscore characters, ... Window toolbar – Alphabetic icon: arranges the properties alphabetically – Categorized icon: arranges the properties by category – Event icon: allows reactions to user actions • To display the Properties ... static void Main() { TimeOfDay time; } } 41 Struct (p .10 7) • Defining Struct struct { ; } • Declare variable of the struct: • Access value of the struct:...
Ngày tải lên: 13/05/2014, 11:30
george g. szpiro - the secret life of numbers 50 easy pieces on how mathematicians work and think
... calendar The Russians stuck to their calendar until the Revolution but were then forced to cross out 13 days The abstruse result was that the October Revolution in fact took place in November 19 17 ... Incorrect Conjecture The Crash of Catastrophe Theory Deceptive Simplicity The Beauty of Dissymmetry Random and Not So Random How Can One Be Sure It’s Prime? 93 97 10 2 10 6 10 9 11 2 11 6 11 9 12 2 12 5 ... computer—with the necessary software having been installed the previous night—into the lecture hall at precisely the right moment, attaches it to the overhead projector, and hands the remote control...
Ngày tải lên: 05/06/2014, 11:25
The C# Programming Language phần 1 ppt
... 352 11 Structs 355 11 .1 11. 2 11 .3 11 .4 Struct Declarations 355 Struct Members 356 Class and Struct Differences 357 Struct Examples 362 12 Arrays 367 12 .1 12.2 12 .3 12 .4 12 .5 12 .6 Array Types ... Preface xiii PART I C# 1. 0 1 Introduction 1. 1 1. 2 1. 3 1. 4 1. 5 1. 6 1. 7 1. 8 1. 9 1. 10 1. 11 1 .12 Hello World Program Structure Types and Variables Expressions 11 Statements 14 Classes and Objects 18 ... 17 .5 Attribute Classes 411 Attribute Specification 414 Attribute Instances 420 Reserved Attributes 422 Attributes for Interoperation 427 18 Unsafe Code 429 18 .1 18.2 18 .3 18 .4 18 .5 18 .6 18 .7 18 .8...
Ngày tải lên: 12/08/2014, 23:23