how a priori knowledge is possible

How people acquire knowledge from a web page: An eye tracking study

How people acquire knowledge from a web page: An eye tracking study

... web pages did not have a navigation menu Eye tracking was used to gather data about students’ learning activity An eye-tracking device was used as a visual gaze analysis tool to identify attention ... attention paid by learners to web objects The task was to gain information about learners’ fixation impact via a gaze plot (a map which shows gaze fixations on a webpage) and heat map (graphical representation ... plot, there is no information about the order of looking on a static heat map Heat maps are a visualization that can effectively show the focus of visual attention for many participants at a time

Ngày tải lên: 10/01/2020, 11:02

18 25 0
(LUẬN VĂN THẠC SĨ) A comparative study on how hesitation and reservedness is expressed via prosodic means in English and the equivalent expressions in Vietnamese

(LUẬN VĂN THẠC SĨ) A comparative study on how hesitation and reservedness is expressed via prosodic means in English and the equivalent expressions in Vietnamese

... hesitation What is shown in this table is that hesitation is marked by fall-rise pitch contour and total duration increase Moreover, the slower speaking rate before than after the pause also ... ordinal number to identify the order of each pause From the automatic analysis of Praat software, we get the speaking rate before and after a pause as shown in the below table Pause in order Speaking ... prosody is simultaneously clarified in both English and Vietnamese language This enables the author to have a good approach in analyzing the similarities and differences of both languages in the later

Ngày tải lên: 28/06/2022, 10:17

60 5 0
researching latin america part two a survey of how the new generation is doing its research

researching latin america part two a survey of how the new generation is doing its research

... investigaciones anteriores realizadas con estudiantes latinoamericanistas estadounidenses Los miembros estudiantiles de la Asociación de Estudios Latinoa- mericanos con direcciones en América Latina ... information-seeking behavior, descriptivas para describir la muestra y las pruebas del Chi-cuadrado fueron utilizadas para comparar estos resultados con los de la encuesta anterior Los encues- tados ... in each of Canada, Cuba, Ecuador, Guatemala, Peru, and Spain Of those listed above, one respondent report-ed studying in both Argentina and France, and another in both Peru and France Similar

Ngày tải lên: 04/12/2022, 16:04

30 2 0
Luận văn thạc sĩ VNU ULIS a comparative study on how hesitation and reservedness is expressed via prosodic means in english and the equivalent expressions in vietnamese

Luận văn thạc sĩ VNU ULIS a comparative study on how hesitation and reservedness is expressed via prosodic means in english and the equivalent expressions in vietnamese

... hesitation What is shown in this table is that hesitation is marked by fall-rise pitch contour and total duration increase Moreover, the slower speaking rate before than after the pause also ... ordinal number to identify the order of each pause From the automatic analysis of Praat software, we get the speaking rate before and after a pause as shown in the below table Pause in order Speaking ... prosody is simultaneously clarified in both English and Vietnamese language This enables the author to have a good approach in analyzing the similarities and differences of both languages in the later

Ngày tải lên: 05/12/2022, 22:22

60 10 0
(LUẬN VĂN THẠC SĨ) A comparative study on how hesitation and reservedness is expressed via prosodic means in English and the equivalent expressions in Vietnamese

(LUẬN VĂN THẠC SĨ) A comparative study on how hesitation and reservedness is expressed via prosodic means in English and the equivalent expressions in Vietnamese

... ordinal number to identify the order of each pause From the automatic analysis of Praat software, we get the speaking rate before and after a pause as shown in the below table Pause in order Speaking ... tries to clarify its concepts and features as well Here, prosody is simultaneously clarified in both English and Vietnamese language This enables the author to have a good approach in analyzing ... /nəu/ is a single syllable which has an onset The F0 value of onset (F0 start value) and the F0 value of the syllable- ending (F0 end value) are measured in Hz From automatic analysis using Praat

Ngày tải lên: 17/12/2023, 02:50

60 9 0
Choose A Company Of Your Interest And Analyze How Its Marketing Mix Is Changing In The Digital Era.pdf

Choose A Company Of Your Interest And Analyze How Its Marketing Mix Is Changing In The Digital Era.pdf

... their marketing efforts and achieve their goals II How digital tools are changing the marketing mix 1 Information about INAX ● INAX is a Japanese brand that manufactures innovative sanitaryware and ... brilliant development to date in the digital age Many activities have been gradually changing the way of organisation and operation, including information activities In order to organise information ... sanitaryware products that are made with recycled materials Trang 9- By collecting data from a variety of sources, INAX is able to gain a deep understanding of its customers' needs and wants This

Ngày tải lên: 14/05/2024, 15:37

17 1 0
Luận văn a comparative study on how hesitation and reservedness is expressed via prosodic means in english and the equivalent expressions in vietnamese

Luận văn a comparative study on how hesitation and reservedness is expressed via prosodic means in english and the equivalent expressions in vietnamese

... a falling tone (e.g: ma), Nang has a drop tone interrupted by a glottalisation (e.g: ma) and Fai is gradually falling then rising in the fasl third back fo the original Laval (vg: mi) A change ... the automatic analysis of Praat software, we get the speaking rate before and afler a pause as shown in the below table Trang 2721 ‘Table 2: Speaking rate (syllables/second) before and after ... prosodic means bslween two languages in which English is a slresselimed language and Vietnamese is a tonal language 2 Aims of the study The main aims of this study arc: - ‘To explore prosodic features

Ngày tải lên: 19/05/2025, 21:19

60 1 0
Luận văn a comparative study on how hesitation and reservedness is expressed via prosodic means in english and the equivalent expressions in vietnamese

Luận văn a comparative study on how hesitation and reservedness is expressed via prosodic means in english and the equivalent expressions in vietnamese

... underestimate that a learner only needs to have a treasury of vocabulary ar good Imowledge of grammar, he can speak English Mucnlly Tt is a concerning problem in teaching and learning a foreign language ... of hesitation via prosodic means bslween two languages in which English is a slresselimed language and Vietnamese is a tonal language 2 Aims of the study The main aims of this study arc: - ... treasury of vocabulary ar good Imowledge of grammar, he can speak English Mucnlly Tt is a concerning problem in teaching and learning a foreign language at schools, universities and centers because

Ngày tải lên: 16/08/2025, 18:54

75 0 0
Japanese Is Possible - Lesson 32

Japanese Is Possible - Lesson 32

... etc.) and Japanese-related sites   Washington's Technical Japanese Program Homepage also has links to Japanese software, even for the Mac   allows internet users without Japanese language software ... environment A 60-day free trial version is also available on the Web They also carry a lot of other Japanese software on their site, including learning software and Japanese word processors, many with ... a Japanese application suite designed specifically for students of Japanese as a second/foreign language This application includes a word processor, multi-lingual HTML editor, and kanji/ vocabulary

Ngày tải lên: 08/11/2012, 15:08

13 409 3
Validating an a priori enclosure using  high order taylor series

Validating an a priori enclosure using high order taylor series

... information is readily available to make both Algorithms I and II fully variable order Remark. Iteration If Task 5 nds that [u](t)[u 0] on [t 0], then we can repeat Tasks 4 and 5 with a largerhor ... interval polynomialsas well as the enclosure of the respective remainders The advantage of this idea of Lohner over the validation strategy discussed in Section 1 is that validation is possible ... Current AWA Approach Validation and the computation of a tight enclosure are separate, though related, issues This paper addresses only the issue of validation, the role of Lohner's Algorithm I

Ngày tải lên: 12/01/2014, 22:06

11 284 0
Tài liệu SWIMMING IN SEWAGE: The Growing Problem of Sewage Pollution and How the Bush Administration Is Putting Our Health and Environment at Risk ppt

Tài liệu SWIMMING IN SEWAGE: The Growing Problem of Sewage Pollution and How the Bush Administration Is Putting Our Health and Environment at Risk ppt

... studies, a publicly avail-able, searchable database, and a public education campaign Lack of adequate informa-tion on waterborne disease is putting people at risk Trang 9CHAPTER 1 C ONTEXT hat goes ... immediately: improper treatment and disposal of wastewaters, aging water treatment and distribution systems, mismanagement of animal wastes, and the current lack of an inte-grated regulatory approach.”30be-The ... oxygen means that fish and other aquatic organisms can’t breath Hypoxic conditions arise, causing fish kills, noxious odors, and habitat loss, and leading to decreased tourism and recreational water

Ngày tải lên: 17/02/2014, 10:20

83 546 0
Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc

Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc

... gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttg gattttttCTGCAGCAGAGCTCGTTTAGTGAACCG Ccttctccccggcggttagtgctgagagtgc aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa Primer ... PCMV-Sport–b-gal plasmid) CGCTATTACCATGGTGATGC (nucleotides 4588–4608 of PCMV-Sport–b-gal plasmid) CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaa aaccccaaaaaaatttacaaaaaaGTCGACaatgc gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttg ... β-gal AR S 5’-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa-3’ (3) TOP-β-gal CMV Transcription start site β-gal Relative abundace of β-gal A PABP expression during heat shock recovery

Ngày tải lên: 18/02/2014, 12:20

19 599 0
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt

Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt

... 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG Reverse ompA105 5¢-GCCATGAATATCTCCAACGAG Reverse ompA117 5¢-CATCCAAAATACGCCATGAATATC Forward 5¢rpsO 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG Reverse 5¢rpsO 5¢-GCTTCAGTACTTAGAGAC Forward ... 5¢-GCTTCAGTACTTAGAGAC Forward 3¢rpsO 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC Reverse 3¢rpsO 5¢-GAAAAAAGGGGCCACTCAGG Reverse 3¢rpsO-(T)18 5¢-T(18)GAAAAAAGGGGCCACTCAGG Forward rpsO internal 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG Reverse ... 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG Reverse 3¢rpsO-(C)18 5¢-C(18)GAAAAAAGGGGCCACTCAGG Reverse 3¢rpsO-(G)18 5¢-G(18)GAAAAAAGGGGCCACTCAGG Reverse 3¢rpsO-(N)18 5¢-GAATTGCTGCCGTCAGCTTGA Forward oxyS109* 5¢-TAATTAACCCTCACTAAAGGGAAACGGAGCGGCACCTCTT Reverse

Ngày tải lên: 19/02/2014, 16:20

10 488 0
Tài liệu Báo cáo khoa học: Transcription of individual tRNA1Gly genes from within a multigene family is regulated by transcription factor TFIIIB pdf

Tài liệu Báo cáo khoa học: Transcription of individual tRNA1Gly genes from within a multigene family is regulated by transcription factor TFIIIB pdf

... formation was analysed by electrophoresis on 4% polyacylamide (nondenaturing) gels and visualized in a Phos-phorimager Lanes as marked The heparin-resistant complex on tRNA1Gly-1 (left) is marked ... -1 with a single TATATAA element in the upstream region (in plasmid construct pRKX3) [24] or the same construct in which the TATATAA sequence was mutated to GATATCA (pRKX3mut) was also carried ... experiments is presented. Trang 7completely abolished when the TATATAA sequencewas mutated to GATATCA (lanes 3, 4) These results were also consistent with the observation that TFIIIB alone was not

Ngày tải lên: 20/02/2014, 02:21

15 485 0
Tài liệu MATERNAL HEALTH IN NIGERIA WITH LEADERSHIP, PROGRESS IS POSSIBLE potx

Tài liệu MATERNAL HEALTH IN NIGERIA WITH LEADERSHIP, PROGRESS IS POSSIBLE potx

... sustainable, and evidence-driven approach that ensures that women have reliable access to quality maternal health services The Ondo approach is not dramatically new; rather, it is an example of how ... Cooke is director of the Africa Program at the Center for Strategic and International Studies (CSIS) in Washington, D.C Farha Tahir is program coordinator and research associate with the CSIS Africa ... Labor management and training of traditional birth attendants are effective in preventing sepsis, and antibiotics are the principal mode of treatment 4 Preeclampsia/Eclampsia: Preeclampsia (also

Ngày tải lên: 21/02/2014, 14:20

22 455 0
Báo cáo khoa học: How a lipid mediates tumour suppression Delivered on 29 June 2010 at the 35th FEBS Congress in Gothenburg, Sweden pdf

Báo cáo khoa học: How a lipid mediates tumour suppression Delivered on 29 June 2010 at the 35th FEBS Congress in Gothenburg, Sweden pdf

... via autophagic membranes in Saccharomyces cerevisiae Genes Cells 13, 537–547 42 Axe EL, Walker SA, Manifava M, Chandra P, Roderick HL, Habermann A, Griffiths G & Ktistakis NT (2008) Autophagosome ... Rabenosyn-5 and its interacting partners causes a loss of both epithelial and planar polarity [47,48] The loss of epithelial polarity is a prevailing characteristic of carcinomas, and muta-tion of Rabenosyn ... proposed to entail activation of autophagy, a catabolic pathway that is considered to mediate tumour suppression by scavenging damaged organ-elles that would otherwise cause DNA instability through

Ngày tải lên: 06/03/2014, 01:23

12 499 0
Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx

Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx

... 365–377 Biswas, G., Adebanjo, O.A., Freedman, B.D., Anandatheerthavarada, H.K., Vijayasarathy, C., Zaidi, M., Kotlikoff, M & Avadhani, N.G (1999) Retrograde Ca2+ signaling in C2C12 skeletal myocytes ... by PCR from total DNA using the primers pADm1 (forward; 5¢-AGCAGTCGACGA AGCGACGAAGTGAAGCTGCGTGA-3¢) and pADm3 (reverse; 5¢-ATCCGTCGACATGCTTTTTAACTGTT CG-3¢) After digestion with SalI (which recognizes ... Adf-1, alcohol dehydrogenase distal factor; GAF, GAGA factor; OXPHOS, oxidative phosphorylation; n-DNA, nuclear DNA; mtDNA, mitochondrial DNA; NRF, nuclear respiratory factor; RACE, rapid amplification

Ngày tải lên: 07/03/2014, 16:20

11 534 0
How a market-driven focus leads companies to build products people want to buy potx

How a market-driven focus leads companies to build products people want to buy potx

... management and marketing professionals trained by Pragmatic Marketing, visit www.pragmaticmarketing.com. Why are we Pragmatic Marketing? People sometimes ask why the company is named Pragmatic Marketing. ... want to buy 16 What is Marketing Anyway? Summarizing, product management is a game of the future Product managers who know the market, identify and quantify problems in a market... sales ... promotional material Working with press or analysts Measuring marketing programs Performing win/loss analysis Approving promotional material Product Manager The Strategic Role of Product Management

Ngày tải lên: 16/03/2014, 01:20

35 328 0
Báo cáo khoa học: R120G aB-crystallin promotes the unfolding of reduced a-lactalbumin and is inherently unstable ppt

Báo cáo khoa học: R120G aB-crystallin promotes the unfolding of reduced a-lactalbumin and is inherently unstable ppt

... R116C aA-crystallin causes cataract in the lens (where aA-crystallin is mainly located), but, because aB-crys-tallin also has considerable extralenticular distribution, it is perhaps not surprising ... aB-crystallin, is also expressed in many nonlenticular tissues, and a natural missense muta-tion, R120G, has been associated with cataract and desmin-related myopa-thy, a disorder of skeletal muscles ... potential for aggregation and precipitation, characteristic of cataract formation The chaperone action of a-crystal-lin helps to minimize these events [2] a-Crystallin is a member of the small heat-shock

Ngày tải lên: 16/03/2014, 18:20

14 366 0
The Transcendental Aesthetic (1): A Priori Intuitions potx

The Transcendental Aesthetic (1): A Priori Intuitions potx

... it states a tautology Peter Strawson, for example, states this claiming that all the argument says is that we could not become aware of objects as spatially related unless we had the capacity ... that it would be possible to experience such separation In relation to alternative views, what is denied here is that space is a notion that could have arisen from particulars and this denial ... relations and is not sufficient to show that the order that is given by space to sensations is something a priori it is true that we have not shown in this argument that space is universally

Ngày tải lên: 16/03/2014, 18:20

10 323 0
w