hepatitis c and hepatocellular carcinoma

... improving the efficiency of certain cancer therapies Experimental procedures Cell culture A human hepatocellular carcinoma HepG2 cell line was purchased from the American Type Cell Collection It derives ... absence (squares) and presence (circles) of pyruvate under normoxic (in black) or hypoxic (in white) conditions Other conditions and statistical calculations are described under Experimental procedures ... abundance of enriched lactate and alanine This is due to the blockade of the tricar-boxylic acid cycle induced by lack of oxygen We examined the peaks corresponding to the glutathione carbons, and...

Ngày tải lên: 18/02/2014, 16:20

... hepatitis B infection and hepatocellular carcinoma (HCC) HCC is a major health problem worldwide and chronic infection with hepatitis B virus (HBV) is a major risk factor for HCC This study can ... diagnosis and treatment of human cancers, including HCC In this chapter, previous studies on HCC, current therapies for HCC and hepatitis B, RNA interference and miRNAs will be discussed 1.1 HCC HCC ... miR-17-92 cluster is one of the best characterized miRNAs and is implicated in the tumorgenesis of several types of human cancers including B-cell lymphoma, breast cancer, colon cancer, lung cancer and...

Ngày tải lên: 14/09/2015, 12:11

... PBT ACLF > CHB 47 ACLF > CHB and HC CD4þCD25þFoxp3þ PBT ACLF > CHB and HC 49,50 CD4þCD25þ PBT ACLF > CHB and HC 28,51 TIT ACLF > CHB and HC CD4þCD45RAFoxp3high PBT and IHT CHB ... HC 46 ACLF > AsC CD4þCD25high PBT ACLF > CHB and HC 52 CD4þCD25þFoxp3þ PBT CHB > HC 53,54 CD25þCD127low/ PBT CHB > AsC, inactive HBsAg carriers and HC 44 CD4þCD39þFoxp3þ PBT AsC ... Tregs Comparisons of Treg frequencies References CD4þCD25þFoxp3þ TIT HCC > HC 77,99 CD4þCD25þFoxp3þ PBT HCC > HC 60,86,94,100e103 CD4þCD25þCD127 PBT HCC > HC 104 CD4þCD25þ PBT HCC > CHB...

Ngày tải lên: 04/12/2022, 16:03

... culture (DCs/allo-HCC); 2) DCs/sp fused with allogeneic HCC cells in the presence of HCCsp during the entire culture (DCs/allo-HCC/sp); 3) OK-DCs fused with allogeneic HCC cells in the absence ... the presence of HCC cell culture supernatants (HCCsp) and allogeneic HCC (DCs/allo-HCC/sp) induce dysfunction of the fused cells and promote the generation of CD4+ CD25high Foxp3+ Treg and impair ... absence of HCCsp during the entire culture (OK-DCs/allo-HCC); and 4) OK-DCs/sp fused with allogeneic HCC cells in the presence of HCCsp during the entire culture (OK-DCs/allo-HCC/sp) Vaccination...

Ngày tải lên: 18/06/2014, 15:20

... Serum OCT concentrations were compared with serum cytokine and chemokine levels, and with disease severity and development of hepatocellular carcinoma (HCC) Results: The median OCT concentrations ... hepatitis C virus (HCV) RNA-positive chronic hepatitis C (CH-C) and liver cirrhosis (LC), and in healthy individuals OCT concentrations, liver histology, and results of blood and biochemical tests ... among OCT concentrations and IP10 and IL18 levels There were weak correlations between serum OCT concentrations and liver histology The cumulative incidence of HCC in the high-OCT concentration...

Ngày tải lên: 15/01/2020, 02:10

... is a C3 convertase C3 is thus split into C3a and C3b, the latter being a C5 convertase that splits C5 into C5a and C5b C3a and C5a are chemotactic; they recruit neutrophils and trigger an inflammatory ... activation generates chemotactic factors, C3a and C5a, which recruit and activate pro-inflammatory leucocytes It also leads to the formation of C5-9, the Membrane Attack Complex that may have ... academic position as a research lecturer at the National Research Center. He is also a Clinical Consultant and Head of the Clinical Research Unit at the Cairo Kid-ney Center, Egypt His main clinical...

Ngày tải lên: 16/01/2020, 01:57

... Materials and Methods Cell culture Human normal hepatocyte line QSG-7701 and human hepatocellular carcinoma cell line MHCC-97H were purchased from the Chinese Academy of Science High metastatic HCC cell ... Results Baicalin was more toxic to cancer cells while less toxic to hepatocytes Previous researches have proved that baicalin could suppress HCC cells including HepG2 and SMMC-7721 and has fewer ... elicited a potential clinical strategy to eliminate hepatocellular carcinoma more sufficiently while alleviating the damage of normal hepatic tissues and provided a conceivable clinical guidance...

Ngày tải lên: 16/01/2020, 02:22

... HBV-induced HCC In our study, genes of cell cycle proteins, namely, cyclin D1 (CCND1), cyclin D2 (CCND2), cyclin E1 (CCNE1), cyclin-dependent kinase (CDK7), transcription factor (E2F1), transcription ... risk factor for hepatocellular carcinoma (HCC) Here we screened for miRNAs in chronic HBV associated HCC Methods: To determine the miRNAs in HCC occurrence associated with HBV infection, we analyzed ... Argonaute RISC catalytic component 2; BCL2: B-cell lymphoma/leukemia 2; BCL2L11: BCL2-like 11; BID: BH3-interacting domain; BIRC5: Baculoviral IAP repeat containing 5; CCND1: Cyclin D1; CCND2: Cyclin...

Ngày tải lên: 06/08/2020, 03:28

... construct 1: 5′-TACTGCTGAC ATACAGTCGGAGGTTCACT-3′ and construct 2: 5′-ACACTCCTCATTTGGATAGGCTTGTAAGT-3′ The scrambled shRNA construct with the pGFP-V-RS back-bone was purchased from OriGene (Cat# ... initiation and growth in lower cell dilutions compared to scrambled shRNA controls (Figure 6B-D), an important TISC characteristic Discussion Hepatocellular carcinoma (HCC), the fifth most common cancer ... samples(Figure 1A and Additional file 1: Figure S1) c-Met+CD44s+HCC cells have increased mesenchymal characteristics To study the potential relationship between CD44s and c-Met in HCC, we characterized...

Ngày tải lên: 30/09/2020, 11:11

... www.nature.com/scientificreports OPEN received: 25 October 2016 accepted: 01 February 2017 Published: 06 March 2017 Inhibiting histone deacetylases suppresses glucose metabolism and hepatocellular carcinoma ... and Hepatology, Mayo Clinic College of Medicine, Rochester, MN, USA 5Department of Laboratory Medicine and Pathology, Mayo Clinic College of Medicine, Rochester, MN, 55905, USA 6Mayo Clinic Cancer ... in HCC cells in culture and in patient specimens and determine the molecular mechanisms underlying its deregulation and its role in HCC cell growth Results Decreased FBP1 expression in HCC tissues...

Ngày tải lên: 04/12/2022, 14:57

... Abstract Background: Liver disease progression from chronic hepatitis C virus (HCV) infection to hepatocellular carcinoma (HCC) is associated with an imbalance between T-helper and T-helper cytokines ... between pro- and anti-inflammatory cytokines Therefore, elevated serum cytokines could be a risk factor for the occurrence of HCC in patients with HCV related chronic hepatitis and cirrhosis Cytokines ... their application at the population level Background Hepatocellular carcinoma (HCC) ranks as the fifth most common cancer around the world and the third most frequent cause of cancer-related...

Ngày tải lên: 13/08/2014, 13:20

... Keywords c-met; hepatocellular carcinoma cells; microRNA-23b; urokinase Correspondence G De Petro, Department of Biomedical Sciences and Biotechnology, Division of Biology and Genetics, University ... corresponding uPA enzymatic activity (C) Western blot detection of GAPDH in control and miR-23b-transfected cells (D) Western blot detection of c-met and GAPDH in cell extracts from control and ... GAPDH, glyceraldehyde 3-phosphate dehydrogenase; HBV, hepatitis B virus; HCC, hepatocellular carcinoma; HCV, hepatitis C virus; HGF, hepatocyte growth factor; hsa-miR-23b, Homo sapiens microRNA-23b;...

Ngày tải lên: 29/03/2014, 23:20

... HCV infection Chronic HCV infection causes hepato cellular carcinoma mainly by direct way Oppositely, patients of chronic hepatitis C often develop into hepato cellular carcinoma (HCC) on cirrhosis ... between HCV genotype and some subclinical, clinical characteristics 2.3 Data collecting and processing: - Collecting date: Collecting tests and clinical information according to the medical reports ... of Clinical Medical and Pharmaceutical Sciences 3 Central Institute for Medical Science Infomation and Tecnology Trang 31 Introduction Hepato cellular carcinoma (HCC) is a popular cancer ranking...

Ngày tải lên: 08/01/2020, 16:39

... virus (HCV) associated hepatocellular carcinoma (HCC) and chronic hepatitis (CH) Egyptian patients The present study included 31 HCC with their ANT, 38 CH and 13 normal hepatic tissue (NHT) samples ... into HCC and CH with high accuracy (89.9%), sensitivity (83.9%) and specificity (94.7%) HCV infection may contribute to hepatocarcinogenesis through enhancing PM of multiple genes PM of APC occurs ... that 80% of HCC occurs in cirrhotic livers, the exact molecular mechanisms underlying virusassociated hepatocarcinogenesis are still unclear Multiple genetic aberrations of oncogenes and tumor suppressor...

Ngày tải lên: 15/01/2020, 16:52

... R C H A R T I C L E Open AccessThe safety and efficacy of transarterial chemoembolization combined with sorafenib and sorafenib mono-therapy in patients with BCLC stage B/C hepatocellular carcinoma ... recommended therapies for advanced hepatocellular carcinoma (HCC), but their combined efficacy remains unclear Methods: Between August 2004 and November 2014, 104 patients with BCLC stage B/C ... Keywords: Hepatocellular carcinoma, Sorafenib, Transarterial chemoembolization, Portal vein tumor thrombus, Adverse events Background Hepatocellular carcinoma (HCC) is the fifth most com-mon cancer...

Ngày tải lên: 06/08/2020, 04:55

... HCC Keywords: Incarvine C, ROCK, Vasculogenic mimicry, Hepatocellular carcinoma Background Hepatocellular carcinoma (HCC) is the sixth most com-mon malignancy and the third most comcom-mon cause ... prostate carcinoma cells PC3 and LNCap; lung cancer A549 cells; colon cancer HCT116 cells; and cervical cancer Hela cells were from the cell bank of the Chinese Academy of Sciences (Shanghai, China) ... metastatic ability of HCC cells is the critical reason for the fatalities associ-ated with HCC [22] The growth and metastasis of HCC cells depend on an effective microcirculation Effective microcirculation...

Ngày tải lên: 23/09/2020, 00:10

... of China Medical University Cell culture and treatment Human hepatocellular carcinoma cell line QGY-7703 and PLC were purchased from the Type Culture Collec-tion of Chinese Academy of Sciences ... of c-Src do not affect the interaction between EGFR and Src Conclusion: c-Src plays a critical role in the invasion and metastasis of HCC induced by association of cell surface GRP78 withα2M* Cell ... surface GRP78 directly binds and phosphorylates c-Src As a consequence, c-Src phosphorylated EGFR, promoting the invasion and metastasis of HCCs Keywords: Cell surface GRP78, Hepatocellular carcinoma,...

Ngày tải lên: 30/09/2020, 10:56

... expression, Hepatocellular carcinoma Background Hepatocellular carcinoma (HCC) is the sixth most com-mon form of cancer worldwide, and it is estimated that there are more than 740,000 new cases each year ... 1R E S E A R C H A R T I C L E Open AccessPeretinoin, an acyclic retinoid, improves the hepatic gene signature of chronic hepatitis C following curative therapy of hepatocellular carcinoma Masao ... Eishiro Mizukoshi1and Shuichi Kaneko1 Abstract Background: The acyclic retinoid, peretinoin, has been shown to be effective for suppressing hepatocellular carcinoma (HCC) recurrence after definitive...

Ngày tải lên: 05/11/2020, 06:15

... of TDTH cells against self-antigens POLYCLONAL LYMPHOCYTE ACTIVATION  A number of viruses and bacteria can induce nonspecific polyclonal B-cell activation (G- bacteria, CMV, EBV) ⇓ inducing the ... dendritic cells, macrophages and cytokines Such responses often lead to the production of granulomas as an expression of chronic stimulation of T cells and macrophages, where there is persistance ... manifestations of keratoconjunctivitis sicca (90%) and xerostomia (80%) - sicca syndrome  When these manifestations occur in the absence of another clearly defined connective tissue disease, the...

Ngày tải lên: 13/08/2014, 09:37

... CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA ... GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT ... TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT AGCCATGGTTT AAACCATGGCTAGAATTCATGGTGGAGTGTCGCCCCCATCAGGGGGCTGGC GCGGCCGCAAA GGCTGCACGACACTCCGCCATGGCTAGACGCTTTC CGTCTAGCCATGGCGGAGTGTCGTGCAGCCTCCAGG CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC...

Ngày tải lên: 20/02/2014, 01:20