given routers a and b describe what names and p

A study on words from names in nguyen nhat anh's stories and their english equivalents

A study on words from names in nguyen nhat anh's stories and their english equivalents

... lazy and < /b> wicked Tam and < /b> Cam are two the contrast characters that stand for the good and < /b> the bad one The names Tam, Cam are used metaphorically, popular among common people to imply the good and < /b> ... vocabulary and < /b> have a < /b> comprehensive understanding about words from names, I have been trying my best to develop the graduation paper through a < /b> descriptive and < /b> comparative analysis, and < /b> gave out many ... human beings E.g.: A < /b> cunning person is a < /b> fox A < /b> spiteful person is a < /b> snake A < /b> rude person is a < /b> bear A < /b> hard working person is a < /b> bee or a < /b> beaver There are many expressions based on names of animals...

Ngày tải lên: 11/12/2013, 23:57

57 541 1
Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt

Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt

... tryptophan catabolism along the kynurenine pathway, and < /b> is a < /b> medically relevant enzyme in light of the important roles played by QA and < /b> PA in physiological and < /b> pathological conditions Indeed, QA ... a < /b> key precursor of NAD, but also a < /b> potent neurotoxin that acts by activating the N-methyl-d-aspartate subtype receptor for glutamate [4] QA imbalance was reported to be associated with a < /b> number ... residues and < /b> solvent molecules engaged in ligand recognition and < /b> stabilization are drawn as balls -and-< /b> sticks and < /b> spheres, respectively The major interactions established between the DHAP inhibitor and...

Ngày tải lên: 18/02/2014, 06:20

9 797 0
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

... (forward primer, 5Â-GGTATTGAGGGTCGCCATGGTTATGTTC AATCACCA-3Â; reverse primer, 5Â-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3Â) The PCR product was puried, treated with T4 exonuclease to create vector-compatible ... initial phase was maintained longer than in the absence of LlCBP3 3A,< /b> indicating that LlCBP3 3A < /b> acts synergistically with LlChi1 8A < /b> However, the effect of LlCBP3 3A < /b> was small and < /b> ceased after approximately ... Fig Substrate preferences for LlCBP3 3A < /b> at pH 6.0 (A,< /b> B) Binding of LlCBP3 3A < /b> visualized by SDS-PAGE (A)< /b> LlCBP3 3A < /b> present in the supernatant after 24 h of incubation with a-< /b> chitin (lane 2), b- chitin...

Ngày tải lên: 18/02/2014, 08:20

14 684 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

... FnBPA-2, FnBPA-3, FnBPA-4, FnBPA-5, FnBPA-6, FnBPA-7, FnBPA-8, FnBPA-9, FnBPA-10, and < /b> FnBPA-11, and < /b> FnBPB-1, FnBPB-2 ⁄ 3, FnBPB-4, FnBPB-5, FnBPB-6, FnBPB-7, FnBPB-8, FnBPB-9, FnBPB-10, and < /b> FnBPB-11, ... BR A < /b> Fn GS BP T Fn ABP Fn AB Fn PABP Fn ABP Fn ABP Fn ABP Fn ABP Fn A-< /b> 8 B Fn PA BP -9 Fn ABP 10 A < /b> -1 20 - Fig Binding of 15E11 to the predicted FnBRs of FnBPB and < /b> FnBPA (A,< /b> C) ELISA Recombinant ... BBP Fn B- 8 B Fn PBBP Fn B- 1 BP B1 1 0.0 D BR G A < /b> ST Fn BP Fn A-< /b> 1 BP Fn A-< /b> 2 BP Fn A-< /b> 3 BP Fn A-< /b> 4 BP Fn A-< /b> 5 BP Fn A-< /b> 6 BP Fn A-< /b> 7 BP Fn A-< /b> 8 BP Fn ABP Fn A-< /b> 1 BP A < /b> -1 C 3.0 20 - A4< /b> 90 nm Fn 2.5 kDa 97 66...

Ngày tải lên: 06/03/2014, 22:21

16 569 0
Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc

Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc

... molmol: a < /b> ¨ program for display and < /b> analysis of macromolecular structures J Mol Graph 14, 51–32 Supplementary material The following supplementary material is available online: Table S1 Proton ... each domain adapts to host the additional copper(I) ions by opening up and < /b> rearranging its N- and < /b> C-terminal parts, minimizing the structural perturbation of its central part The arrangement ... distorted chair The C-terminal a-< /b> domain is characterized by an adamantane-like four-metal cluster Solution structures of 113 Cd-substituted Cd7MT-2 from rabbit, rat and < /b> human are available and < /b> revealed...

Ngày tải lên: 07/03/2014, 09:20

14 486 0
Báo cáo khoa học: Binding of the volatile general anesthetics halothane and isoflurane to a mammalian b-barrel protein doc

Báo cáo khoa học: Binding of the volatile general anesthetics halothane and isoflurane to a mammalian b-barrel protein doc

... given < /b> in Table Halothane displaces 1-aminoanthracene (AMA) bound to the internal cavity in the hydrophobic core of porcine odorant binding protein Figure shows that halothane can displace AMA from ... the porcine odorant binding protein cavity The competition curve was treated as a < /b> two parameter Table Dissociation constants and < /b> thermodynamic data for the binding of halothane and < /b> isoflurane ... residues, such as arginine or lysine, with the remaining two composed of aliphatic and < /b> somewhat polar residues such as serine, phenylalanine, and < /b> asparagine The crystallographic results are in accord...

Ngày tải lên: 07/03/2014, 16:20

9 422 0
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx

Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx

... HCl buffer, pH 6.8– 8.5, at 21 °C (2) HbA modified with pyridoxal 5¢-phosphate (PLPHbA), 1.6 mol PLP per tetrameric HbA, 50 mM K2HPO4 buffer, pH 7.4, at 20 °C (3) PLP-HbA, 6.0 mol PLP per tetrameric ... The authors thank Anna V Chistyakova and < /b> Dr Nona V Konovalova for preparing protein solutions This work was supported by the Belarusian Republican Foundation for Fundamental Research (Grant B0 0-176) ... affinity, K, can be derived for both the a < /b> and < /b> b subunits from the averaged parameters of HbA oxygenation (Table 1, Average) The association and < /b> dissociation rate constants for the b subunits are found...

Ngày tải lên: 16/03/2014, 14:20

11 578 0
The a and b adapters are used as priming sites for both amplification

The a and b adapters are used as priming sites for both amplification

... Step 1: Preparation of the DNA • DNA is fragmented by nebulization • The DNA strand’s ends are made blunt with appropriate enzymes • A< /b> and < /b> B adapters are ligated to the blunt ends using DNA ... not allow more than one ssDNA bead to be loaded into a < /b> well • Enzyme beads and < /b> packing beads are added Enzyme beads containing sulfurase and < /b> luciferase, and < /b> packing beads used only to keep the ... ligase • The strands are denatured using sodium hydroxide to release the ssDNA template library (sstDNA) The Adapters • The A < /b> and < /b> B adapters are used as priming sites for both amplification and...

Ngày tải lên: 19/03/2014, 22:32

19 392 0
Báo cáo khoa học: Unprecedented pathogen-inducible complex oxylipins from flax – linolipins A and B docx

Báo cáo khoa học: Unprecedented pathogen-inducible complex oxylipins from flax – linolipins A and B docx

... Oxo-phytodienoic ¨ acid-containing galactolipids in Arabidopsis: jasmonate signaling dependence Plant Physiol 145, 1658–1669 4472 47 Buseman CM, Tamura P, Sparks AA, Baughman EJ, Maatta S, Zhao ... linolipins Partial spectrum for (A)< /b> lipolipin A < /b> and < /b> (B) linolipin B Signals above 5.25 p. p.m belong to olefinic protons and < /b> those below 5.25 p. p.m to protons of glycerol and < /b> galactose moieties The attribution ... of arabidopsides in any other tested species except Arabidopsis thaliana and < /b> Arabidopsis arenosa Thus, linolipins constitute a < /b> second family of oxylipin-esterified galactolipids along with the arabidopsides...

Ngày tải lên: 23/03/2014, 05:22

10 388 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

... Hsp90 [16] Results PP30[hHsp9 0a]< /b> and < /b> PP30[hHsp9 0b] ) yeast strains that express human Hsp9 0a < /b> or Hsp9 0b as their sole Hsp90 S cerevisiae strains PP30[pHSC8 2b] , PP30[pHSP82] and < /b> PP30[hHsp9 0b] are ... efficiencies, both of the yeast and < /b> both of the human isoforms of Hsp90 indicated that the levels of Hsp90 expression in strains PP30[pHSC8 2b] , PP30[pHSP82], PP30[hHsp9 0a]< /b> and < /b> PP30[hHsp9 0b] were comparable, ... Hsp90s but 5¢ homologies to plasmid pBDC [34] (Hsp9 0a,< /b> forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp9 0b, forward primer...

Ngày tải lên: 23/03/2014, 07:20

11 428 0
Báo cáo Y học: Substrate selectivity and sensitivity to inhibition by FK506 and cyclosporin A of calcineurin heterodimers composed of the a or b catalytic subunit potx

Báo cáo Y học: Substrate selectivity and sensitivity to inhibition by FK506 and cyclosporin A of calcineurin heterodimers composed of the a or b catalytic subunit potx

... is a < /b> more potent inhibitor of both CaNa and < /b> CaNb than CyPA/CsA Activation of CaNa and < /b> CaNb phosphatase activity by FKBP12/FK506 toward pNPP In contrast to the inhibition of CaN phosphatase activity ... recombinant CnAa and < /b> CnAb baculoviruses (Fig 1B, C) Kinetic assays of CaNa and < /b> CaNb phosphatase activity Fig SDS/PAGE and < /b> Western blot analysis of baculovirus expressed CaN composed of CnAa or CnAb ... the activities of CaNa and < /b> CaNb toward pNPP, we examined the activation of CaNa and < /b> CaNb phosphatase activities toward pNPP by FKBP12/FK506 As shown in Fig 5, a < /b> twofold increase in CaN phosphatase...

Ngày tải lên: 24/03/2014, 03:21

9 474 0
Báo cáo khoa học: Identification of the N-termini of NADPH : protochlorophyllide oxidoreductase A and B from barley etioplasts (Hordeum vulgare L.) ppt

Báo cáo khoa học: Identification of the N-termini of NADPH : protochlorophyllide oxidoreductase A and B from barley etioplasts (Hordeum vulgare L.) ppt

... of PORA and < /b> PORB of barley and < /b> POR from pea are homologous, and < /b> that Pchlide cannot bind to the PORA transit peptide of pPORA as recently proposed [22] Results Acetylation of the POR protein and < /b> ... oxidoreductases A < /b> and < /b> B: a < /b> branched pathway for light-dependent chlorophyll biosynthesis in Arabidopsis thaliana Plant Physiol 108, 1505–1517 Oosawa N, Masuda T, Awai K, Fusada N, Shimada H, Ohta H & Takamiya ... protein, corroborating our finding [5] The sequences of PORA and < /b> PORB from barley and < /b> POR from pea were aligned using clustal w (http://npsa-pbil.ibcp.fr/cgi-bin/npsa_auto mat.pl?page=npsa_clustalw.html)...

Ngày tải lên: 30/03/2014, 02:20

8 363 0
Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx

Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx

... TMAP and < /b> TOPPRED2 programs Determination of the exon/ intron boundaries were obtained by analysis of the rat genomic sequences available in the NCBI database The programs used are all available ... transferase Gal transferase Gal transferase Gal transferase Gal transferase Gal transferase IGb3 synthetase IGb3 synthetase Forssman synthetasea Forssman synthetase Human Rat Pig Mouse Human Platyrrhini ... Table Identification of the ABO gene family sequences used for the phylogenetic analysis Enzyme Species GenBank/EBI A < /b> transferase A < /b> transferase A < /b> transferase A < /b> (cis A/< /b> B) transferase A-< /b> likea Gal...

Ngày tải lên: 31/03/2014, 09:20

8 500 0
Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc

Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc

... generate the recombinant plasmids pGL 3b: Prm1; pGL 3b: Prm2 and < /b> pGL 3b: Prm3, each in pGL3Basic and < /b> pGL3e:Prm1; pGL3e:Prm2 and < /b> pGL3e:Prm3, each in pGL3Enhancer The fidelity of all recombinant plasmids ... reporter vectors pGL3 Basic (pGL 3b) and < /b> pGL3 Enhancer (pGL3e) to generate the recombinant plasmids pGL 3b: Prm1, pGL 3b: Prm2, pGL 3b: Prm3, pGL3e:Prm1, pGL3e:Prm2 and < /b> pGL3e:Prm3 (B) The plasmids pGL 3b: Prm1 ... the TPa and < /b> TPb mRNAs (Eur J Biochem 269) 4069 Fig Effect of PMA on promoter activity and < /b> TPb mRNA expression levels pGL 3b: Prm1 or pGL3e:Prm1 (A)< /b> , pGL 3b: Prm2 or pGL3e:Prm2 (B) pGL 3b: Prm3, or pGL3e:Prm3...

Ngày tải lên: 31/03/2014, 09:20

16 323 0
Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx

Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx

... Xenopus Rat TATTGGACCTGGAGATAGGTACTGACACGC Mouse TTTGGGCCGCCGGGTTATATGCTGACACGC 216 bases TGCCTTATATGTTCGTCTGTAGGAGCGAGT GCATGTGCGGGCAGGAAGGTAGGGGAAGAC GATC Drosophila TATTGTACCTGGAGATATATGCTGACACGC ... TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG Consensus (1851) TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG ... G AG AAG G G G AG TCTTCTCG TAG ACCG AG AAG ACCTACCTG CAACAAAAAATG G T G G G CTG AG CTTCAACCCCCCCTCTCAG AG AAG CTCATCTTCTG CTG ATG ACCG TTTTTTACA G G G TTG 80 CAT (ng/well) 70 60 50 40 tI 30 pI...

Ngày tải lên: 18/06/2014, 18:20

12 567 0
báo cáo hóa học:" Aflatoxin levels, plasma vitamins A and E concentrations, and their association with HIV and hepatitis B virus infections in Ghanaians: a cross-sectional study" pdf

báo cáo hóa học:" Aflatoxin levels, plasma vitamins A and E concentrations, and their association with HIV and hepatitis B virus infections in Ghanaians: a cross-sectional study" pdf

... lab analyses, interpreted lab data, and < /b> revised the paper CP supervised vitamins A < /b> and < /b> E analysis and < /b> interpreted the data, and < /b> revised the paper RD supervised statistical analysis, interpretation ... of Alabama at Birmingham, Birmingham, Alabama, USA 5St Markus Hospital, AIDS ALLY, Kumasi, Ghana 6Department of Nutrition Sciences - Nutritional Biochemistry and < /b> Genomics, University of Alabama ... plasma from participants at the UAB Hospital Laboratory This included tests of the liver enzymes aspartate aminotransferase (AST) and < /b> alanine aminotransferase (ALT), liver transport (direct bilirubin),...

Ngày tải lên: 20/06/2014, 08:20

10 380 0
MODELLING AIDS EPIDEMIC AND TREATMENT WITH DIFFERENCE EQUATIONS K. M. TAMIZHMANI, A. RAMANI, B. pot

MODELLING AIDS EPIDEMIC AND TREATMENT WITH DIFFERENCE EQUATIONS K. M. TAMIZHMANI, A. RAMANI, B. pot

... critical value, the fixed point becomes repulsive and < /b> we have appearance of a < /b> limit cycle: the populations vary periodically with an asymptotically constant amplitude We have carried out numerical ... ramani@cpht.polytechnique.fr B Grammaticos: GMPIB, Universit´ Paris VII, case 7021, 75251 Paris, France e E-mail address: grammati@paris7.jussieu.fr A < /b> S Carstea: Institute of Physics and < /b> Nuclear ... it is a < /b> systematic, algorithmic approach which, moreover, generates systems that encapsulate the essential, albeit in a < /b> bare-bones version, dynamical behavior of the initial system In what follows,...

Ngày tải lên: 23/06/2014, 00:20

11 144 0
w