... friction at the wall against Kp for different values of magnetic parameter M and heat source parameter S are entered in Tables and respectively From Table 1, we observe that a growing magnetic parameter ... Unsteady free convective MHD flow and mass transfer past a vertical porous plate with variable temperature Bull Cal Math Soc.2005, 97 (2), 137-146 [15] Ogulu A. , Prakash J Heat transfer to unsteady ... acting as the honourary member of editorial board of Indian Journal of Science and Technology and as Referee of AMSE Journal, France; Central European Journal of Physics; International Journal...
Ngày tải lên: 05/09/2013, 16:10
... propositional case We may also conclude that (AA x B), because both are actual paths which terminate with the same label a, and n o n - T labels are unique The representative extended feature graph at ... actually part of it The root node is denoted by ®, and nodes with value T are denoted with a Note that paths with common virtual end labels (e.g., AA and B) are not coalesced; virtual nodes and ... Drew and Rounds, William C (1987), "A logic for partially specified data structures," in: A/ t-Kaci, lla.qsan (1984), A lattice-theoretic apllroach to coniputation based oil a calculus of partiallyordered...
Ngày tải lên: 22/02/2014, 10:20
Creating a glass object with max and vray
... cheked and on V-ray shadows parameters check Transparent shadows and area shadow Use a plane for the scene and assign a white color to this It looks fine, but not really :) The glass need something ... reflect To this use a HDRI map You can find some HDRI images at this address http://athens.ict.usc.edu/Probes/ and assign this to V-ray Environment and the result And with caustics the scene will ... Image Sampler(Antialising), turn of the Adaptive subdivision For the glass materials use this settings: and for the liquid this For the lighting I have used an Omni light, V-ray shadows cheked and...
Ngày tải lên: 01/04/2014, 17:32
working with templates and nvu
... affiliate program and have made yourself familiar with resource area located here: http://www.moreniche.com/webmasters/ Downloading and extracting the template Select the template you like and save ... review.html page How to insert an image It is hard to imagine web pages without pictures They liven up a page and draw the eye in Too much text without being broken up with images can mean a dull and ... have a basic understanding of Windows XP, as well as how to work with folders, opening and saving files, etc Also this guide assumes you are registered and approved webmaster of MoreNiche™ affiliate...
Ngày tải lên: 28/04/2014, 17:10
Báo cáo y học: "Circadian phase-shifting effects of a laboratory environment: a clinical trial with bright and dim light" ppsx
... ages 20–40), mean and SE Age Group Baseline aMT6s Acrophase Final aMT6s Acrophase Baseline Circadian Malsynch Final Circadian Malsynch Baseline Circadian Dispersion Final Circadian Dispersion ... Journal of Circadian Rhythms 2005, 3:11 Figure Circadian malsynchronization at baseline and final assessment Circadian malsynchronization at baseline and final assessment Shown is circadian malsynchronization, ... differed, on average, by 0.03 hours Baseline aMT6s acrophase was compared across treatment and age group via × ANOVA Final aMT6 acrophase was determined from urinary data collected during the final 24–30...
Ngày tải lên: 10/08/2014, 09:20
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents
... implications 2.2.2 Gradable and non- gradable adjectives According to L G Alexander (1988, 108) adjectives can be also divided into gradable and non- gradable Gradable adjectives mean a large class ... features of contrastive analysis in learning a foreign language which has particular effect on analyzing a language and its equivalents in other languages and then the author would like to make ... now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central concern...
Ngày tải lên: 10/04/2013, 14:46
Start With English 1 Unit 1 A B C D
... Find out your number no yes a B C D cat cap dog doll apple ant book bag cat cap dog doll auto ...
Ngày tải lên: 19/08/2013, 01:10
An experimental investigation of heat transfer and fluid flow in a rectangular duct with inclined discrete ribs
... [1] Saini J.S Use of artificial roughness for Enhancing Performance of Solar air heater Proceedings of XVII National and VI ISHME/ASME Heat and Mass Transfer Conference, IGCAR, Kalpakkam India 2004; ... in a rectangular rib roughened passage” International Journal of Heat and mass transfer; 123: 675-681, 2001 [6] Lau S.C., McMillin R.D and Han J.C Turbulent Heat transfer and friction in a square ... rectangular duct Int Journal of Heat and Mass Transfer1999; 42: 1597-1615 [16] Karwa R, Experimental studies of augmented heat transfer and friction in asymmetrically heated rectangular ducts with...
Ngày tải lên: 05/09/2013, 16:10
Structural and semantic features of english idioms referring to head and a contrastive analysis with vietnamese idioms
... example: with a high hand (in a haughty way) This idiom cannot be shortened in any circumstances, we also cannot say with a tall hand although high and tall are similar In contrast, a proverb is ... effective and interesting way because they contain not only the literal meanings but the figurative and expressive meanings as well They are an integral part of a language and they make the language ... by an amount of water or steam in a confined space For example: They kept up a good head of steam 16 (in place names) a headland For example: Beach head 17 A main division in a lecture, an essay,...
Ngày tải lên: 20/12/2013, 18:33
Tài liệu Chapter 19. Mail and Address Book Email is a fast, cheap, convenient communication medium. pptx
... they're easy to set up and maintain, and because they offer many of the same features as IMAP servers Luckily, Mail can read and send email through Exchange servers as though your Mac were just another ... a fifth kind, but if you follow the instructions at http://members.aol.com/adamkb/aol/mailfaq/imap/applemail.html, you can read your AOL mail as if it came from a regular IMAP account.) POP accounts(Post ... Mail on the laptop, you'll find your messages and attachments already in place IMAP servers (Internet Message Access Protocol) are newer and have more features than POP servers, but aren't as...
Ngày tải lên: 21/01/2014, 06:20
Tài liệu COUNSELING and PSYCHOTHERAPY with ARABS and MUSLIMS A Culturally Sensitive Approach doc
... earth “Wabtag i fema a tak Allah al-dar el-aakhera wala tansa nasibak men al-dunia” (Al-Qusas #77) [But seek, by means of that which God has given you, to attain the abode of the hereafter and ... happen to anybody This belief is documented in the verse, “Qol lan yosibuna illa ma katab Allah lana howa mawlana wa ala Allah falyatawakal el-mo amenin” (Al-tawbah #51) [Say: Nothing will befall us ... authoritarian/collective and liberal/individualistic societal models For instance Malaysia, Pakistan, Saudi Arabia, and Libya are more authoritarian and collective than Lebanon, Turkey, Tunis, and...
Ngày tải lên: 15/02/2014, 15:20
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT ... AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG...
Ngày tải lên: 19/02/2014, 05:20
Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx
... ⊕6 A · gi , i=1 where g1 = and g2 , g3 , , g6 can be chosen to be homogeneous of degree 5, 6, 6, 7, 12 (This data was obtained with the commands InvariantRing, PrimaryInvariants, and SecondaryInvariants ... Annals of Mathematics, 163 (2006), 723–741 The number of extensions of a number field with fixed degree and bounded discriminant By Jordan S Ellenberg and Akshay Venkatesh* Abstract We give an ... successive maxima and Remark 3.2 rather than just Lemma 3.1 This seems like an interesting optimization question; the gain for small n can be significant although one does not obtain an exponent near Proof...
Ngày tải lên: 06/03/2014, 08:21
CORREGGIO A COLLECTION OF FIFTEEN PICTURES AND A SUPPOSED PORTRAIT OF THE PAINTER, WITH INTRODUCTION AND INTERPRETATION pot
... falls away and shows the body as it had been bared for the scourging It is a beautiful form, perfectly developed, and the arms and hands are as delicately modelled as a woman's The face is oval, ... Madonna della Scodella) Before the child Jesus was two years old, he was taken on a journey which at that time was long and tedious An angel appeared to Joseph one night in a dream, saying, "Arise, ... describes an artist's meditations while trying to draw a hand [18]His failure teaches him to realize that he must study the "Flesh and bone and nerve that makeThe poorest coarsest human handAn object...
Ngày tải lên: 06/03/2014, 13:20
Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_2 pptx
... said about being as handy Start with what looks like a ridiculously brief as possible, it requires a detailed answer light weight, and try a few reps, focusing on your balance and form Go up a ... positions-neutral (palms facing each other) off from training, you scale back the weights and overhand (palms down) as well as the you use and allow your body to catch up on its traditional palms-up ... total-body program is in another league If training programs were animals, HFT for Arms would be a pit bull- a tough sumbitch by any standard- while Total-Body HFT is Sasquatch The end results are...
Ngày tải lên: 14/03/2014, 23:20
Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_3 pot
... vertical than you can with a traditional squat, and thus increase your range of motion UP: Return to the starting position and exhale 242 VARIATIONS: 2» 1» FAST PARTIAL FRONT SQUAT SUPRAMAXIMAL ... Get Big, Phases and 3; Get Even Bigger, HFT for Arms and Total-Body HFT; Get Strong, Phases lA, 2A , and 3A; Get Even Stronger, Phases lA, 2A, and 3A; Get Lean, Phases lA, 2A, and 3A HOW TO DO ... Phases lA, 2A, and PREP: Set a cable pulley on its lowest position and attach a straight bar, V handle, or rope Grab the bar, handle, or rope and step back so that your arms are straight and there's...
Ngày tải lên: 14/03/2014, 23:20