get a user by his her id

A User Identity Management Protocol for Cloud Computing Paradigm

A User Identity Management Protocol for Cloud Computing Paradigm

... applications quickly and to scale up applications as much as when needed The platform supports traditional Java™ and Linux, Apache, MySQL, PHP (LAMP) stack-based applications as well as new architectures ... accessibility of a service An online service is available if a user or program can gain access to the pages, data, or services provided by the site when they are needed This is critical to UCS Unavailability ... Unavailability of a web site may hinder the on-going transactions and it may lead to loss of money and customers Technologies such as load balancing hardware and software are aimed at ensuring availability...

Ngày tải lên: 31/07/2013, 09:43

12 383 0
Do it yourself home energy audit: A step-by-step guide for identifying and improving your home’s energy efficiency pot

Do it yourself home energy audit: A step-by-step guide for identifying and improving your home’s energy efficiency pot

... sealant or spray foam Apply caulk where you need a flexible seal at narrow joints; weatherstripping is used where two surfaces move against each other, like at a window; and spray foam is an ... any air sealing, ensure that you have either sealed combustion appliances, or that there is an alternate means (e.g wall vents) for the appliance to draw outside air In all cases combustion appliances ... caulk or spray foam to seal leaks Attic/Crawl Space/Basement Use spray foam to seal irregular gaps around pipe and wire penetrations Caulk is effective for small holes In attics, crawlspaces and...

Ngày tải lên: 06/03/2014, 23:20

24 455 0
The Project Gutenberg eBook, The Business of Being a Woman, by Ida M. Tarbell pptx

The Project Gutenberg eBook, The Business of Being a Woman, by Ida M. Tarbell pptx

... formulated And she has this advantage: custom makes it cowardly for a man to attempt to demonstrate that woman is a tyrant—it laughs and applauds woman's attempt to fix the charge on man It gives her ... never taught her that— how best to guide Toward peace this thing that sleepeth at her side And she who, laboring long, shall find some way Whereby her lord may bear with her, nor fray His yoke ... MACMILLAN & CO., LIMITED LONDON · BOMBAY · CALCUTTA MELBOURNE THE MACMILLAN CO OF CANADA, LTD TORONTO THE BUSINESS OF BEING A WOMAN BY IDA M TARBELL ASSOCIATE EDITOR OF THE "AMERICAN MAGAZINE" AUTHOR...

Ngày tải lên: 28/06/2014, 17:20

334 393 0
how to get a higher ielts score by building a positive image in the examiner''''''''s mind

how to get a higher ielts score by building a positive image in the examiner''''''''s mind

... others when read by a native speaker 4 Types of Grammar Mistakes That Annoy an Assessor the Most Mistake Type #1 VERB TENSE a) Talking about the data b) Talking about the actual graph or diagram ... to identify key trends and compare and contrast patterns, don’t just repeat lists of facts Why it? Don’t make personal comments Why it? Use a systematic layout Create and arrange other paragraphs ... background material to be taken to a two day, academic seminar overseas The lecturer is flying overseas for that seminar at lunchtime This ‘professional and academic test persona’ is a more suitable...

Ngày tải lên: 30/07/2014, 12:22

65 434 0
Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx

Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx

... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCGAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC t p.G60V ... Gorilla gorilla Pongo pygmaeus Macaca mulatta Callithrix jacchus TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... chromosomal abnormalities using Illumina genomewide SNP array as well as exon-targeted array comparative genomic hybridization (aCGH) CNV analysis did not identify potential disease-causing chromosomal...

Ngày tải lên: 09/08/2014, 23:20

36 449 0
Immobilization of heavy metals in sediment dredged from a seaport by iron bearing materials

Immobilization of heavy metals in sediment dredged from a seaport by iron bearing materials

... houses are non-standard, unsanitary and highly infectious In some areas, medical wastes are urgent matters because there have been no places for wastes to be gathered even in provincial hospital ... dumping waste bags to roadsides In particular, Hanoi has thousands of medical stations, making up about 2% of total wastes Only 60 hospitals and medical centers have signed up for waste treatment ... premises Medical wastes include injurious medical wastes and common wastes  Injurious medical wastes are medical wastes which contain factors that can harm man’s health and environment Those factors...

Ngày tải lên: 23/09/2012, 15:38

10 723 0
HOW TO GET A JOB.

HOW TO GET A JOB.

... the class just went back to their old jobs or back to Daddy's firm I had neither That made me kinda sick, a bit angry and a bit cheated that I had been spun this yarn And more than a bit ashamed ... provided it is solidly put together So avoid negativity, hints of failure and of giving any clues that you are at all fazed by any past hiccups ProFile Career Dynamics, 2001 This report may be ... your answers, get behind the advert language as we discussed above If you actually get face-to-face with an agent, consider yourself fortunate Because you can now ask questions you can't ask of an...

Ngày tải lên: 06/11/2012, 15:40

36 578 0
a decentralized approach for implementing identity management in cloud computing

a decentralized approach for implementing identity management in cloud computing

... a hybrid misuse-anomaly detection approach to take advantage of anomaly detection’s ability to detect new attacks, but without the approach’s accompanying high rate of false positives There are ... Identity Management There are several solutions for deploying IdM, as introduced above In the isolated IdM model, services are owned and managed by separate service providers and each provider provides ... which may take incompatible identity technology and attributes and credentials In personal IdM (Personal Authentication Management), an entity manages identities by itself.[8] In [4], the authors...

Ngày tải lên: 31/07/2013, 09:43

7 591 0
A Fun Way to Generate Ideas for Comparison Paragraphs.doc

A Fun Way to Generate Ideas for Comparison Paragraphs.doc

... students to this activity in pairs or small groups, in order to generate as many points and supporting sentences as possible Conclusion Usually, these paragraphs are so good that you may want to copy ... chickens, fish, banks, hospitals, etc Fold the pieces of paper and put them into a hat Go to each group, and ask one member to take two pieces These are the nouns that must be compared To help students ... the board: " and are similar in many ways." Tell the students to simply fill in the blanks with the two nouns they randomly selected Depending on the size of the class, I usually ask students...

Ngày tải lên: 06/09/2013, 05:10

2 345 0
Would a Roshanda by Any Other name smell as sweet

Would a Roshanda by Any Other name smell as sweet

... names and hippie names, nostalgic names and place names Increasingly, there are brand names (Lexus, Armani, Bacardi, Timberland) and what might be called aspirational names The California data ... 303 174 Lauren Ashley Amanda A Roshanda by Any Other Name Megan Samantha Hannah 10 Rachel 11 Nicole 12 Taylor 13 Elizabeth 14 Katherine 15 Madison 16 Jennifer 17 Alexandra 18 Brittany 19 Danielle ... Heather 10 Amber Emily Hannah Madison Sarah Samantha Lauren Ashley Emma Taylor 10 Megan A single holdover: Sarah So where these Emilys and Emmas and Laurens all come from? Where on earth did Madison...

Ngày tải lên: 17/10/2013, 18:20

26 590 0
Tài liệu Module 4: Designing a User Data Management Strategy pptx

Tài liệu Module 4: Designing a User Data Management Strategy pptx

... of evaluating user data management options based on organizational needs and the current and planned environment Categorizing User Data Management Needs Identifying Available User Data Management ... network share that belongs specifically to that user An example of data entered by a user that is not considered user data would be data that a user enters into a database This kind of data is entered ... a way to easily categorize data management needs by different classifications Categorizing Data Management Needs by Job Type Lead-in Categorizing Data Management Needs by User Location To analyze...

Ngày tải lên: 10/12/2013, 15:15

48 451 0
Tài liệu 20 Terabytes a Night  by Doug Rosenberg with Matt Stephens doc

Tài liệu 20 Terabytes a Night  by Doug Rosenberg with Matt Stephens doc

... bad weather and the fact that they can’t get any air cover Patton launches into a tirade that ends with: “If we are not victorious, LET NO MAN COME BACK ALIVE.” His aide pulls him aside and says: ... database enables a diverse multidisciplinary research program: astronomy &  astrophysics; machine learning (data mining); exploratory data analysis; extremely large  databases; scientific visualization; computational science & distributed computing; and  ... looks like a nail because all we’ve got is a hammer”. In this case the nail is a use case, and the  hammer is a use case diagram.  Note that starting from a minimalist modeling subset and tailoring up is a very different approach  from that taken by processes such as Rational Unified Process (RUP), which start with everything ...

Ngày tải lên: 13/12/2013, 00:15

46 397 0
Tài liệu The message of a master - By John McDonald pdf

Tài liệu The message of a master - By John McDonald pdf

... perfumed ay an abundance of flowers artistically arranged, to a room which appeared to be his study and where chairs had already been placed for us His entry immediately after was followed by a round ... self, and we questioned as to whether we would ever see him again But here he was back again, and surely some great change had taken place in him Remarking that a miracle must have happened, he assured ... serve it and therefore you And again, automatically, positive conditions and individuals are attracted to you as surely as the steel particles are attracted to the magnet That is the first reason...

Ngày tải lên: 15/12/2013, 06:15

50 866 0
Structural and semantic features of english idioms referring to head and a contrastive analysis with vietnamese idioms

Structural and semantic features of english idioms referring to head and a contrastive analysis with vietnamese idioms

... unpleasant) appear again after being hidden or forgotten For example: -Political corruption has reared its ugly head again -Famine has raised its head again in many parts of the world (Oxford Idioms ... Sundays, many families have a traditional meat at home: grilled meat with potatoes, vegetables and gravy For many English people, dinner is a main meal and the whole family often have dinner together ... word meanings This way of naming is based on another way of naming available in a language with a relationship between the two ways Some linguists call this the indirect way of naming For instance,...

Ngày tải lên: 20/12/2013, 18:33

43 1,8K 13
Tài liệu Module 5: Designing a User Settings Management Strategy pdf

Tài liệu Module 5: Designing a User Settings Management Strategy pdf

... cannot add to or change standard hardware settings Users cannot play games and not have access to unapproved applications Data-Entry Workers Users have no Start menu or desktop icons Users cannot ... install and configure software Users not have access to Control Panel or other system tools Users cannot add to or change standard hardware settings Users cannot play games and not have access ... options available for managing user settings You can determine those that address your organizational needs and are therefore most appropriate to include in your user settings management plan After...

Ngày tải lên: 21/12/2013, 05:16

36 319 0
w