g gene into dna plasmid form recombinant dna

Lập bản đồ gene của DNA ty thể potx

Lập bản đồ gene của DNA ty thể potx

... enzyme công cụ hữu hiệu để phân tích di truyền Nó sử dụng khơng để phân tích mtDNA nấm men, mà mtDNA sinh vật miễn chiết tách tinh DNA di truyền * Bản đồ mtDNA nấm men người Việc xây dựng đồ mtDNA ... đồ mtDNA hoàn chỉnh nấm men người thành tựu đáng kể nghiên cứu di truyền tế bào chất - Một số trình tự có codon khởi codon kết thúc cuối chưa biết chức - mtDNA người dư thừa ... lớn tiếp cận dựa vào đoạn mtDNA đột biến petite Sự kết hợp kiểu phân tích di truyền đặc biệt với kỹ thuật tái tổ hợp DNA dẫn đến xây dựng đồ di truyền hoàn chỉnh mtDNA - Lập đồ phân tích restriction...

Ngày tải lên: 04/04/2014, 05:22

3 453 1
Báo cáo khoa học: "Radiosensitization and growth inhibition of cancer cells mediated by an scFv antibody gene against DNA-PKcs in vitro and in vivo" docx

Báo cáo khoa học: "Radiosensitization and growth inhibition of cancer cells mediated by an scFv antibody gene against DNA-PKcs in vitro and in vivo" docx

... identified by screening a humanized phage library using purified DNA- PKcs epitopes The gene encoding anti -DNA- PKcs-scFv was cloned and transfected into HeLa cells HeLa cells expressing anti-DPK3scFv ... much longer than that of HeLa and HeLapcDNA cells after 4Gy g- ray radiation (Figure 5A) Residual DNA damage in HeLa-DPK3-scFv cells was significantly higher than that of HeLa and HeLa-pcDNA cells ... independent experiments DNA- PKcs activity detection DNA- PKcs activity was detected using the Signa-TECT® DNA- Dependent Protein Kinase Assay System (Promega), Page of 11 in which a DNA- PK biotinylated...

Ngày tải lên: 09/08/2014, 09:20

11 372 0
Báo cáo y học: "MethMarker: user-friendly design and optimization of gene-specific DNA methylation assays" pptx

Báo cáo y học: "MethMarker: user-friendly design and optimization of gene-specific DNA methylation assays" pptx

... Herman JG: Inactivation of the DNArepair gene MGMT and the clinical response of gliomas to alkylating agents N Engl J Med 2000, 343:1350-1354 Hegi ME, Diserens AC, Godard S, Dietrich PY, Regli L, ... the MGMT gene promoter, highlighting important decisions, necessary validation experiments and potential stumbling blocks The raw data for Genome Biology 2009, 10:R105 http://genomebiology.com/2009/10/10/R105 ... download package The MGMT gene encodes a DNA repair protein, which removes alkyl groups from the O6-position of guanine, therefore protecting the DNA from accumulating excessive damage [24] It has...

Ngày tải lên: 09/08/2014, 20:20

10 445 0
Recombinant DNA2  kỹ thuật tái tổ hợp DNA  bản dịch đính kèm

Recombinant DNA2 kỹ thuật tái tổ hợp DNA bản dịch đính kèm

... (3) marking target protein using a proper primary and secondary antibody to visualize Blot type Target Probe Applications Southern DNA DNA or RNA mapping genomic clones estimating gene numbers ... life stages in the frog Xenopus laevis 22 http://www.xenbase.org/WWW/Marker_pages /CNS/sybII.html Summary • • • • Southern DNA on membrane Digest DNA Convert dsDNA to ssDNA Probe with DNA or RNA ... blot (DNA) Southern Blot: DNA- DNA* Uses gel electrophoresis together with hybridization probes to characterize restriction fragments of genomic DNA (or DNA from other sources, such as plasmids)...

Ngày tải lên: 24/10/2017, 19:02

91 194 0
Báo cáo " Vector construction and transformation of 4CL1 gene into Chinaberrytree (Melia azedarach L.)" ppt

Báo cáo " Vector construction and transformation of 4CL1 gene into Chinaberrytree (Melia azedarach L.)" ppt

... Chinaberrytree using PCR method with specific primers sequence of Chinese red pine Forward Primer (4CL1P1):5’TATCCATGGCGCATGGCCAA CGGAATCA 3’ ; Reverse Primer (4CL1P2): 5’CGCCGCTCTAGATTTCATTTTGCTGCA GTC 3’ ... purified 4CL1 gene was ligated into vector pPTN289 using T4 DNA ligase The ligation mixture was transformed into E.coli strain TOP10 using heat-shock method (42oC in 90 seconds) Recombinant E.coli ... 4CL1 gene using PCR method and NcoI/XbaI double digestion Figure Plasmids from transformed Agrobacterium tumefaciens Line M: 1kb DNA ladder; Line 1- line 4: A tumefaciens C1-C4 Figure is plasmids...

Ngày tải lên: 22/03/2014, 09:20

7 303 1
báo cáo khoa học: " Introgression of Swertia mussotii gene into Bupleurum scorzonerifolium via somatic hybridization" pptx

báo cáo khoa học: " Introgression of Swertia mussotii gene into Bupleurum scorzonerifolium via somatic hybridization" pptx

... Plant regeneration - B (UV30 s) 82 clones fast growing 14 clones with further regeneration of shoots or roots Green plant from clones C (UV1 min) 66 clones fast growing clones with further regeneration ... directions Degenerate primers targeting the gene from Arabidopsis thaliana encoding cytochrome P450 monooxygenase (Additional file 2) were applied to the cDNA templates The amplicons derived from degenerate ... Shandong Province of China (grant no JQ200810), and ‘Science &Technology Plan of Shandong Province’ (grant no 2009GG10002001) We acknowledge the linguistic help given by http://www.smartenglish.co.uk...

Ngày tải lên: 11/08/2014, 11:22

10 173 0
recombinant dna part g

recombinant dna part g

... b, 5-pg target; row c, 0.5-pg target; row d, 0.25-pg target; row e, 0.05-pg target; row f, no target Column 5: As for column except that plasmid pT7T3-19CMV DNAs (containing a cloned cytomegalovirus ... amounts of CMV plasmid DNAs captured from human urine Row a, 67-pg target; row b, 6.7-pg target; row c, 0.67-pg target; row d, 0.33-pg target; row e, 0.067-pg target; row f, no target The filter ... General Hospital, Edinburgh EH4 2XU, Scotland J ALTENBUC~INER (40), Institute of Industrial Genetics, University of Stuttgart, D-7000 Stuttgart 1, Germany MICHELLE A ALTING-MEES (42), Strategene...

Ngày tải lên: 11/04/2014, 10:26

677 302 0
Báo cáo khoa học: "Protection of chicken against very virulent IBDV provided by in ovo priming with DNA vaccine and boosting with killed vaccine and the adjuvant effects of plasmid-encoded chicken interleukin-2 and interferon-g" doc

Báo cáo khoa học: "Protection of chicken against very virulent IBDV provided by in ovo priming with DNA vaccine and boosting with killed vaccine and the adjuvant effects of plasmid-encoded chicken interleukin-2 and interferon-g" doc

... using the primers IL-2F (5'-GCCGCCGCCATGATGTGCAAAGTACTGATCTT T-3') and IL2-R (5'-TTATTTTTGCAGATATCTC-3'), which were synthesized based on the published ChIL-2 sequence [36] The sequence GCCGCCGCC, ... with pcDNA-ChIL-2 (50 g) , pcDNA-VP243 (100 g) with pcDNA-ChINF-γ (50 g) , or sterile PBS (pH 7.4), was administered directly into the amniotic sac using a inch 23-gauge needle The hatching rates ... immunity against IBDV Surviving chickens of the boosted groups, including the vaccine control, had higher antibody titers after the challenge than the challenge control group, suggesting that the...

Ngày tải lên: 07/08/2014, 23:22

9 295 0
Báo cáo sinh học: "Tissue distribution of a plasmid DNA encoding Hsp65 gene is dependent on the dose administered through intramuscular delivery" docx

Báo cáo sinh học: "Tissue distribution of a plasmid DNA encoding Hsp65 gene is dependent on the dose administered through intramuscular delivery" docx

... minutes, using the primer pairs 5'- ACC AAC GAT GGC GTG TCC AT-3' and 5'- TAG AAG GCA CAG TCG AGG-3', resulting in a 400bp cDNA encoding Hsp65, or the primer pairs 5'- GTG GGC CGC TCT AGG CAC CAA-3'and ... BGH primer pairs (5'-TAA TAC GAC TCA CTA TAG GG- 3' and 5'-TAG AAG GCA CAG TCG AGG- 3') Amplified DNA was analyzed by ethidium bromide staining after 1% agarose gel electrophoresis The methylation ... g/ ml) Rescued plasmids were analyzed by restriction mapping (data not shown), insert release and by PCR using primers (5'- ATG GCC AAC ACA ATT GCG TAC-3' and 5'- TTG AGC AGG TCC TCG TCG TAC TCA C-3')...

Ngày tải lên: 14/08/2014, 19:22

10 245 0
Tài liệu Các plasmid và sự truyền DNA ở vi khuẩn doc

Tài liệu Các plasmid và sự truyền DNA ở vi khuẩn doc

... chúng khác Plasmid tái mạnh tạo 50 tế bào, plasmid khác cho Có nhiều loại plasmid E coli Các plasmid nghiên cứu kỹ plasmid R, Col F Plasmid R g i plasmid kháng thuốc chúng có mang gene kháng với ... - vector tạo dòng dùng DNA sequencing - với vị trí khởi điểm tái (ori), gene kháng AmpR TetR số vị trí enzyme cắt giới hạn (xem chương 8) Plasmid F (F = fertility), g i plasmid giới tính hay nhân ... loại kháng sinh (Hình 6.8) Plasmid Col có khả tổng hợp colicin - protein giết chết vi khuẩn họ hàng không mang plasmid Col Hình Các plasmid vi khuẩn: pSC101 (trái), plasmid siêu xoắn (giữa), pBR322...

Ngày tải lên: 21/01/2014, 14:20

5 365 1
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... (UUAGGG) r[ UUAGGG(UUAGUG) UUAGGG] Table Amino acid sequences of RGG1 and RGG3 RGG1 RGG3 PGENRSMSGPDNRGRGRGGFDRGGMSRGGRGGGRGGMG SAGERGGFNKPGGPMDEGPDLDLGPPVDP APKPEGFLPPPFPPPGGDRGRGGPGGMRGGRGGLMDRGGP ... d(CATTCCCACCGGGACCACCAC) d(CATTCCCACCGGGACCACCACCATTCCCACCGGGACCACCAC) d(TCTCTCGGTGGCCGGGGCTCGTCGGGGTTTTGGGTCCGTCC) d[ AGGG(TTAGGG) ] d[ AGGG(TTAGGG) ]⁄ d[CCCTAA) CCCT] ( 3 d[ AGGG(TTAGTG) TTAGGGJ r ... – RGG3 – + – 545 + – + – RGG3 + + C 656 + – 587 RGG3 KGG3-2 KGG3-4 KGG3-6 KGG3-4 KGG3-6 – + + + KGG3-2 – RGG3 B A AdoMet 610 MF RGG RGG D RGG F RGG RGMD RGG F MF KGG KGG D RGG F RGG RGMD RGG F...

Ngày tải lên: 15/02/2014, 01:20

11 788 0
Tài liệu Báo cáo khoa học: Novel aspects of heat shock factors: DNA recognition, chromatin modulation and gene expression ppt

Tài liệu Báo cáo khoa học: Novel aspects of heat shock factors: DNA recognition, chromatin modulation and gene expression ppt

... bookmarks genes by preventing condensin action Nat Cell Biol 10, 1318–1323 68 Sarge KD & Park-Sarge OK (2009) Mitotic bookmarking of formerly active genes: keeping epigenetic memories from fading Cell ... ‘‘puffing’’ Puffing reflects the changes in chromatin structure that lead to the disruption of nucleosomes along the coding region of HSP genes Unlike yeast HSP genes, the DNase I hypersensitive region of ... Mayhew CN, Lubert EJ, Skaggs HS, Goodson ML, Hong Y, Park-Sarge OK & Sarge KD (2005) Mechanism of hsp70i gene bookmarking Science 307, 421–423 67 Xing H, Vanderford NL & Sarge KD (2008) The TBPPP2A...

Ngày tải lên: 18/02/2014, 04:20

10 566 0
Báo cáo khoa học: Human telomeric G-quadruplex: structures of DNA and RNA sequences ppt

Báo cáo khoa học: Human telomeric G-quadruplex: structures of DNA and RNA sequences ppt

... with a G (e .g d[GGG (TTAGGG)3], d[GGG(TTAGGG)3TT] and d[GGG(T TAGGG)3TTA]), also adopt Form in K+ solution [47] Despite the presence of only two G- tetrad layers, Form adopted by d[GGG(TTAGGG)3T] ... sequence d(GGGTTAGGGTTAGGGT) and the single-repeat human telomeric sequence d(TAGGGT) in Na+ solution [30] and in K+ solution (unpublished results) (F) Basket-type form observed for d[A(GGGTTA)3GGG] ... [28,29,32–54] The d[TAGGG(TTA GGG)3] and d[TAGGG(TTAGGG)3TT] sequences form predominantly intramolecular (3 + 1) G- quadruplexes Form [39–44,46] (Fig 3H) and Form [41,45,46] (Fig 3I), respectively...

Ngày tải lên: 06/03/2014, 09:22

11 480 0
..GENE CLONING AND DNA ANALYSIS..GENE CLONING AND DNA ANALYSISAn IntroductionT.A. BROWNFaculty of Life Sciences University of Manchester ManchesterSixth EditionA John Wiley & Sons, Ltd., Publication. pdf

..GENE CLONING AND DNA ANALYSIS..GENE CLONING AND DNA ANALYSISAn IntroductionT.A. BROWNFaculty of Life Sciences University of Manchester ManchesterSixth EditionA John Wiley & Sons, Ltd., Publication. pdf

... GC C G C T G GA GG G C GG CG A CC T Left cohesive end (b) The circular form of the λ DNA molecule C C cos site G TG G CC CG A GGCA C C GC T GG (c) Replication and packaging of λ DNA cos cos cos ... as recombinant DNA technology or genetic engineering, and having at their core the process of gene cloning, sparked another great age of genetics They led to rapid and efficient DNA sequencing ... Applications of Gene Cloning and DNA Analysis in Research 163 10 11 12 Sequencing Genes and Genomes 165 Studying Gene Expression and Function 185 Studying Genomes 207 Part III The Applications of Gene Cloning...

Ngày tải lên: 06/03/2014, 22:20

338 5,8K 1
Báo cáo khoa học: Assembly of nuclear DNA-encoded subunits into mitochondrial complex IV, and their preferential integration into supercomplex forms in patient mitochondria doc

Báo cáo khoa học: Assembly of nuclear DNA-encoded subunits into mitochondrial complex IV, and their preferential integration into supercomplex forms in patient mitochondria doc

... patient 2, the progression of Cox6a into complex IV is effectively stalled, suggesting that the underlying defect may be related to a late stage in complex IV biogenesis Assembly of nDNA-encoded complex ... complex IV biogenesis We found that, in the presence of pre-existing complex IV, newly imported nDNAencoded subunits can integrate into the holoenzyme as well as into its supercomplex forms Furthermore, ... signal increasing over time (Fig 1B, lanes and 3) For the presequence-containing subunits Cox4-1, Cox6a and Cox7a, an additional faster-migrating species accumulated, representing the mature form...

Ngày tải lên: 07/03/2014, 00:20

13 315 0
Báo cáo khoa học: DNA polymerase e associates with the elongating form of RNA polymerase II and nascent transcripts pot

Báo cáo khoa học: DNA polymerase e associates with the elongating form of RNA polymerase II and nascent transcripts pot

... slowly migrating forms of RNA pol II, antibodies to Pol e coprecipitated only the slowly migrating form of RNA pol II (Fig 1) This suggested that Pol e associates with the RNA pol IIO isoform To ... represented by irregular or DNA polymerase e associates with RNA polymerase II ring-shaped aggregates of gold particles of  50– 100 nm diameter (Fig 4B) Staining with antibody G1 A is specific for ... relocalized to damaged areas, where it gave a uniform staining 5540 (Fig 5, upper panel) Staining with an antibody against nucleotide excision repair factor XP-A gave a comparable staining pattern (data...

Ngày tải lên: 07/03/2014, 11:20

15 585 0
Báo cáo Y học: A novel DNA repair enzyme containing RNA recognition, G-patch and specific splicing factor 45-like motifs in the protozoan parasite Toxoplasma gondii potx

Báo cáo Y học: A novel DNA repair enzyme containing RNA recognition, G-patch and specific splicing factor 45-like motifs in the protozoan parasite Toxoplasma gondii potx

... follows: a-tubulin 5¢-ATGAGAG AGGTTATCAGCATC-3¢ and 5¢-TTAGTACTCGTCAC CATAGCC-3¢; for TgDRE, 34S13 sens: 5¢-ATGCTGGA CTCTCTCTACGGGGAT-3¢ and 34AS15 antisens: 5¢-TT AGTCGAGGGGTTTGTCTGC-3¢ PCR products ... performed using internal oligonucleotides S10 5¢-GT CGAGATGTTGGTTGTCGGAGACC-3¢ for 5¢ RACE and PR2AS 5¢-GACCGTTACCACTGATTGCGGCTG 3¢ for 3¢ RACE The PCR products were cloned into the TA cloning ... using a Marathon cDNA Amplification Kit (Clontech) with the adaptor primer and specific oligonucleotides N34AS 5¢-CTTCACCTGGAGGAGATTTCC AAA-3¢ for 5¢ RACE and N34S 5¢-GGGAGGGTC TCGGCGTCAACAAAC-3¢ for...

Ngày tải lên: 08/03/2014, 22:20

9 422 0
Recombinant DNA I - Basics of molecular cloning Polymerase chain reaction cDNA clones and screening

Recombinant DNA I - Basics of molecular cloning Polymerase chain reaction cDNA clones and screening

... sources together with DNA ligase Restriction endonucleases generate ends that facilitate mixing and matching GAATTC CTTAAG GAATTC CTTAAG EcoRI cut G AATTC CTTAA G G AATTC CTTAA G Mix and ligate G AATTC ... G Recombinant molecules G AATTC CTTAA G GAATTC CTTAAG GAATTC CTTAAG Parental molecules DNA ligase covalently joins two DNA molecules • Uses ATP or NADH to provide energy to seal nicks DNA ligase ... and P1 phage can carry large fragments of DNA – 20 kb for lambda – 70 to 300 kb for P1 • M13 phage vectors can be used to generate single-stranded DNA YAC vectors for cloning large DNA inserts...

Ngày tải lên: 13/03/2014, 18:39

23 462 0
Chapter 8: Recombinant DNA Technology

Chapter 8: Recombinant DNA Technology

... isolating a specific gene? Figure 8.12 Example of cloning a gene by complementation of mutations: cloning of the yeast ARG1 gene Electrophoresis    Describe the two apposing forces that allows DNA ... DNA)  What are the general steps used to clone DNA?     Isolate DNA from an organism Cut the organismal DNA and the vector with restriction enzymes making recombinant DNA Introduce the recombinant ... fragments to be separated by size in gel electrophoresis How are DNA fragments detected in an agarose gel? How are the sizes of DNA fragments determined in an agarose gel? Figure 8.14 An agarose...

Ngày tải lên: 13/03/2014, 19:33

44 1,9K 1
Báo cáo Y học: DNA supercoiling in Escherichia coli is under tight and subtle homeostatic control, involving gene-expression and metabolic regulation of both topoisomerase I and DNA gyrase docx

Báo cáo Y học: DNA supercoiling in Escherichia coli is under tight and subtle homeostatic control, involving gene-expression and metabolic regulation of both topoisomerase I and DNA gyrase docx

... the lacI q1 gene are surrounded by a DNA fragment originating from upstream the gyrA gene and a fragment containing the N-terminal part of the gyrA gene To create a plasmid for integration of ... regions containing DNA from the gyrA locus on pGYRABTS with DNA fragments taken from upstream the topA gene and a fragment containing the N-terminal part of the topA gene pGYRABTS was ®rst digested ... i.e 5¢-CGAA GAAGGGCGGGGAGAAAT-3¢ +bp1870±1850, i.e 5¢TCCATAGCAGCGGCGAAACCA-3¢ and chromosomal DNA from strain LM1237 [17] as a template The PCR fragment was subsequently digested with the enzymes...

Ngày tải lên: 18/03/2014, 01:20

8 483 0
w