frozen for a moment here in time

... 0.81 ATcAAACA 0.03 c ATtAAACA 0.01 c ATGcAACA 0.69 ATGgAACA 0.20 c I ATGAgACA 0.02 c ATGAAgCA 0.05 c ATGAAAgA 0.30 III ATGAAACg 0.26 a PREs represented in the FUS1 promoter (Fig. 4B). b RCS for each oligo ... significant Table 1. RCS of mutant PREs for binding of wild-type Ste12 to a PRE consensus (ATGAAACA) in vitro. FUS1 PRE a Sequence RCS b II ATGAAACA 1.00 IV tTGAAACA 0.27 c AaGAAACA 0.14 ATaAAACA 0.81 ATcAAACA ... is able to bind to a single PRE in vitro. This indicates that either the activation domain of Ste12 is incapable of activating transcription when bound to a single site, or that binding to a single...

Ngày tải lên: 06/03/2014, 22:21

... case, whicharefusedtothetwoterminiofatargetprotein.With this structural constraint, it is fairly safe to assume that a change in FRET with CYIIB monitors a conformational change in TFIIB. Similar FRET-based conformational indicators ... ratio at time t and at in nity, respectively. An error bar indicates the SD of each data point from the average value. Results Design and biochemical integrity of CYIIB To gain more insight into ... conserved linker containing several charged residues, hereafter termed a charged cluster domain (CCD), critical for maintaining TFIIB conformation [5,8,9]. In 1994, Roberts and Green [4] proposed a mechanism for...

Ngày tải lên: 07/03/2014, 15:20

... most recent lava flows from the flanks of Aragats include Tirinkatar, which is separated into two individual trachy- basalt flows Tirinkatar-1 and Tirinkatar-2, and the Ash- tarak lava flow. Tirinkatar-1 ... two-stage approach to estimate lava flow hazard at a nuclear power plant site near Aragats, a Quaternary volcano in Armenia. Keywords: lava flow simulation, modeling code, probabilistic hazard assessment, ... the lava flow simulation area) comprising lava flows from Shamiram, Atomakhumb, Dashtakar, Blrashark, and Karmratar volcanoes. The ANPP site (black box) is located on the Shamiram Plateau. Photo...

Ngày tải lên: 21/06/2014, 19:20

... Boundary Value Problems 16 C. A. Santos, “On ground state solutions for singular and semi-linear problems including super-linear terms at in nity,” Nonlinear Analysis: Theory, Methods & Applications. ... phenomena, for instance, in the theory of quasiregular and quasiconformal mappings 1–3, in the generalized reaction-diffusion theory 4, in the turbulent flow of a gas in porous medium and in the ... Goncalves and C. A. Santos, “Existence and asymptotic behavior of non-radially symmetric ground states of semilinear singular elliptic equations,” Nonlinear Analysis: Theory, Methods & Applications,...

Ngày tải lên: 21/06/2014, 20:20

... Moudafi 7 introduced the viscosity approximation method for nonexpansive mappings see 8 for further developments in both Hilbert and Banach spaces.Letf be a contraction on H. Starting with an ... the above proof that Theorem 2.2 is valid for nonexpansive mappings. Thus, we have that Corollaries 2.3 and 2.4 are two special cases of Theorem 2.2. Corollary 2.3. Let T be a nonexpansive mapping ... nonexpansive mappings,” Numerical Functional Analysis and Optimization, vol. 19, no. 1-2, pp. 33–56, 1998. 6 Fixed Point Theory and Applications Substituting 2.9 into 2.8,weobtainthat   x n −...

Ngày tải lên: 21/06/2014, 23:20

... designing data converters for audio and multimedia appli- cations. Currently he works for the Nano-Meter Analog Integration Branch, as a Design Manager of the Advanced Analog Cells Section, in charge ... signals for the FIR filter. without dramatically increasing unit capacitance. Based on behavioral-level simulations, the minimum allowable c apac- itance value was chosen. Six-phase clock signals ... reduced, resulting in a relaxed settling time and slew rate specifications. This also results in area and power savings, since a single-stage low-voltage and low-power am- plifier can be used for the...

Ngày tải lên: 22/06/2014, 22:20

Ngày tải lên: 14/08/2014, 20:20

... Primers ã Primers define the DNA sequence to be amplified they give the PCR specificity. ã Primers bind (anneal) to the DNA template and act as starting points since DNA polymerases cannot initiate DNA synthesis ... temperatures Thermus aquaticus, a thermophilic bacteria discovered in 1969 in hot spring of Yellowstone National park . It can tolerate high temperature. The DNA polymerase (Taq polymerase) was isolated. Where ... elongation step.  Taq polymerase is the DNA polymerase I for Thermus aquaticus; a bacterium that lives in hot springs.  Many of its enzymes (including DNAP I) will not denature at high temperatures Thermus...

Ngày tải lên: 07/07/2014, 18:20

... Critical Care Vol 13 No 1 Ruskin Page 2 of 2 (page number not for citation purposes) aerospace medical researchers, and the traveling public. Sand and colleagues’ study should serve as a template for future ... for future research in this important area. Competing interests The author declares that they have no competing interests. References 1. Sand M, Bechara FG, Sand D, Mann B: Surgical and medical emergencies ... Committee, Aero- space Medical Association: Emergency medical kit for com- mercial airlines: an update. Aviat Space Environ Med 2007, 78: 1170-1171. 5. European Joint Aviation Authorities: JAR-OPS1,...

Ngày tải lên: 25/10/2012, 10:06

... Dutoit, Maria Astrinaki, Onur Babacan, Nico- las d’Alessandro, and Benjamin Picart. 2011. pHTS for Max/MSP: A Streaming Architecture for Statistical Parametric Speech Synthesis. Technical Report ... Ryu Takeda, Toru Takahashi, Tetsuya Ogata, and Hiroshi G. Okuno. 2010. Analyzing User Utterances in Barge -in- able Spo- ken Dialogue System for Improving Identification Ac- curacy. In Proceedings ... Association for Computational Linguistics INPRO_iSS: A Component for Just -In- Time Incremental Speech Synthesis Timo Baumann University of Hamburg Department for Informatics Germany baumann@informatik.uni-hamburg.de David...

Ngày tải lên: 16/03/2014, 20:20

... signals, results have been obtained for all the records in the databases both preserving and removing the baseline wandering. A simple method that can easily work in real -time operation has been ... leads, the output information rate obtained is about 65 Kbit/s. Although the storage capacity in informa- tion systems as well as network bandwidth increases quickly, an efficient storage and transmission ... calcu- lated for each index. Baseline frequencies are placed in A5 subband. When guaranteeing WWPRD h , A5 subband weight is constant and takes a value of 6/27. On the other h and, when guaranteeing...

Ngày tải lên: 22/06/2014, 23:20

... time- frequency analysis, pattern recognition. 1. INTRODUCTION The ideal software radio (SR) [1] can accommodate all exist- ing bands and modes in a host terminal or, more generally, in a platform. Toward ... standards at a particular time instant and at a given fre- quency. An adaptive receiver provided with such information could use it to cancel the reciprocal interference of the two modes in an intelligent ... signal in an explicit and robust way; (ii) obtaining such a result by a low computational load. Time- Frequency Analysis for Mode Identification 1789 [6] R.D.MurchandK.B.Letaief, “Antennasystemsforbroad- band...

Ngày tải lên: 23/06/2014, 01:20

... Sichuan Agricultural University, China. Animals were bred and maintained in an accredited facility at the Institute of Poultry Sciences in Sichuan Agricultural Uni- versity (Sichuan, China), and ... strain of GPV, was obtained from Key Laboratory of Animal Diseases and Human Health of Sichuan Province. Aleutian disease virus (ADV), canine parvovirus (CPV), porcine parvovirus, (PPV), Newcastle ... 3122-3143 GPV-FP 6FAM-FTCGCAATGCCA ATTTCCCGAGGP TAMRA 3098-3120 VP3-1 AAGCTTTGAAATGGCAGAGGGAGGA 3008-3033 1658 VP3-2 GGATCCCGCCAGGAAGTGCTTTATTTGA 4637-4665 Virology Journal 2009, 6:142 http://www.virologyj.com/content/6/1/142 Page...

Ngày tải lên: 12/08/2014, 04:20

Ngày tải lên: 13/08/2014, 23:20

Ngày tải lên: 08/08/2012, 17:20

Ngày tải lên: 04/10/2012, 10:02

Ngày tải lên: 04/10/2012, 10:02

Ngày tải lên: 04/10/2012, 10:02

... potential links to data quality. This understand- ing provides insight into potential errors (bias and random error) related to data based on clinical examina- Acta Veterinaria Scandinavica 2009, ... central to minimizing variation and bias, regardless of the later use of the data for quantitative analyses. Definitions of accuracy and pre- cision here are defined in accordance with Dohoo et al. [11]. ... veterinarians when their decision making procedures and motivation to collect data are so different. Conclusion Variation and bias in data based on clinical examinations can be linked to veterinarians'...

Ngày tải lên: 25/10/2012, 10:45

... 2005;106: 40 6a. 27. Oka Y, Tsuboi A, Murakami M, Hirai M, Tominaga N, Nakajima H, Elisseeva OA, Masuda T, Nakano A, Kawakami M, Oji Y, Ikegame K, Hosen N, Udaka K, Yasukawa M, Ogawa H, Kawase I, ... Hospital Organization, Osaka Minami Medical Center, Osaka, Japan 6. Department of Functional Diagnostic Science, Osaka University Graduate School of Medicine, Osaka, Japan  Corresponding author: ... Manabu Kawa- kami 5 , Yoshihiro Oka 6 , Haruo Sugiyama 6 and Masuhiro Takahashi 1 1. Laboratory of Hematology and Oncology, Graduate School of Health Sciences, Niigata University, Niigata,...

Ngày tải lên: 26/10/2012, 09:39