formula for standard form of a circle

Using compensation strategies in listening for 10th form students a case study at the high school for gifted students of vinh university

Using compensation strategies in listening for 10th form students a case study at the high school for gifted students of vinh university

... learning stylepreferences and needs, planning for an L2 task, gathering and organizing materials,arranging a study space and a schedule, monitoring mistakes, and evaluating tasksuccess, and evaluating ... comprehension as a process ofacquiring the meaning of the message based on the incoming language data fromsounds, to words, to grammatical relationships, and ultimately to the meaning.Schemata are hierarchically ... knowledge and global understanding to comprehendthe meaning of a message As Nauman (2002: 25) sees that top-down process “focus on the overall meaning of a passage and the application of schemata.Schemata

Ngày tải lên: 27/12/2013, 20:26

99 806 0
Báo cáo toán học: "A closed formula for the number of convex permutominoes" pot

Báo cáo toán học: "A closed formula for the number of convex permutominoes" pot

... operator ϑ performs on P operation (α), and one application of operations (β) and (γ) for any cell in cn ii P satisfies U2 (and not U1) The operator ϑ performs on P operation (δ), and one application ... produce all the objects of a given class, according to the growth of a certain parameter (the size) of the objects Basically, the idea is to perform “local expansions” on each object of size ... a di Siena, Dipartimento di Scienze Matematiche e Informatiche, Pian dei Mantellini 44, 53100 Siena, Italy (rinaldi@unisi.it). † Universit` a di Firenze, Dipartimento di Sistemi e Informatica,

Ngày tải lên: 07/08/2014, 15:22

17 295 0
Development of DMC controllers for temperature control of a room deploying the displacement ventilation HVAC system

Development of DMC controllers for temperature control of a room deploying the displacement ventilation HVAC system

... nonlinear system of partial differential equations The system also has a large time delay because of the slowness of the heat exchange The goal of the paper is to develop a controller that will maintain ... simulated the exterior surface and was assumed to be at a constant value of 320K A 3-D Cartesian mesh inside room was generated by GAMBIT with a uniform grid spacing of 3" In the following sections, ... deploying the displacement ventilation HVAC system Zhicheng Li1, Ramesh K Agarwal1, Huijun Gao2 1 Department of Mechanical Engineering and Materials Science, Washington University in Saint Louis,

Ngày tải lên: 05/09/2013, 16:11

12 557 0
Báo cáo hóa học: " An FIR Notch Filter for Adaptive Filtering of a Sinusoid in Correlated Noise" potx

Báo cáo hóa học: " An FIR Notch Filter for Adaptive Filtering of a Sinusoid in Correlated Noise" potx

... fre-quency variances are equated A beamforming application is also simulated where the actual angle-of–arrival of the signal is 4◦ and the initial es-timate is 0◦ Figure 10 shows the convergence of the ... of the beamformer (θ0=0◦) 5 APPLICATION TO BEAMFORMING The proposed method is well suited to be applied in beam-forming applications with angle-of-arrival estimation Con-sider an array ofN sensors ... estimate An application of the algorithm to beamforming is included for angle-of-arrival estimation Simulation results are presented for a sinusoid in correlated noise, and compared with those for

Ngày tải lên: 22/06/2014, 23:20

10 452 0
Báo cáo sinh học: "Optimal design for the detection of a major gene segregation in crosses" potx

Báo cáo sinh học: "Optimal design for the detection of a major gene segregation in crosses" potx

... Nevertheless, as stated by Gofhnet et al (1994), evidencing major gene segregation without marker information will remain Trang 2important for various i) genetic maps may not be available for all species;ii) ... systematic use of molecular markers is very costly; iii) statistical analysis of phenotype distributions is a useful preliminary analysis of available data; and iv) retrospective studies of old ... ratio u for a dominant gene and when considering an additive gene with a small number of parental individuals (t = 5/6). In situations with an additive gene with a larger proportion of parental

Ngày tải lên: 09/08/2014, 18:21

11 369 0
Báo cáo y học: "Mechanisms employed by retroviruses to exploit host factors for translational control of a complicated proteome" pot

Báo cáo y học: "Mechanisms employed by retroviruses to exploit host factors for translational control of a complicated proteome" pot

... translation, encapsidation, or both? In the cytoplasm, the retroviral primary transcript (pre-mRNA) plays a dual role as unspliced mRNA template for translation and as genomic RNA that is encapsidated ... recapitulate IRES activity A possible caveat is that the transfected RNAs may fail to interact with necessary IRES-transacting factors (ITAFs) in the nucleus An alternative approach to measure ... in vitro translation assays determined that Gag can modulate translation of a reporter RNA that contains the HIV-1 5' UTR [6] The translational output of the tran-script was increased in response

Ngày tải lên: 13/08/2014, 05:21

20 367 0
Báo cáo y học: " Construction of doxycyline-dependent mini-HIV-1 variants for the development of a virotherapy against leukemias" pps

Báo cáo y học: " Construction of doxycyline-dependent mini-HIV-1 variants for the development of a virotherapy against leukemias" pps

... -rtTAΔ7 A rtTAΔ7 B LAI MEPVDPRLEPWKHPGSQPKTACTTCYCKKCCFHCQVCFTTKALGISYGRKKRRQRRRPPQGSQTHQVSLSK NL4-3 N M AH.N A HIV-rtTA A rtTAΔ6A N M AH.N A rtTAΔ7A A M AH.N A rtTAΔ6B N M AH.N A rtTAΔ7B A ... Jeeninga - r.jeeninga@amc.uva.nl; Barbara Jan - janbarbara@hotmail.com; Henk van den Berg - h.vandenberg@amc.uva.nl; Ben Berkhout* - b.berkhout@amc.uva.nl * Corresponding author Abstract T-cell acute ... HIV-rtTA was originally designed as a novel attenuated virus vaccine candidate To minimize the possibility of reversion to normal TAR-Tat regulated transactivation, inactivating mutations were made

Ngày tải lên: 13/08/2014, 09:20

12 318 0
Báo cáo y học: " Evidence for horizontal transfer of a secondary metabolite gene cluster between fungi" potx

Báo cáo y học: " Evidence for horizontal transfer of a secondary metabolite gene cluster between fungi" potx

... that are arranged as a large tandem duplication (in M grisea) The fact that the A clava-tus ACE1 cluster forms a clade with the M grisea part B genes (to the exclusion of the part A genes) means ... horizontal transfer from a relative of M grisea into an ancestor of A clavatus provides a much simpler explanation of the observed data than the alternative of multiple events of duplication and ... phylogenetic analyses KHW drew the figures All authors contributed to writing the manuscript All authors read and approved the final manuscript Additional data files The following additional data are available

Ngày tải lên: 14/08/2014, 08:20

10 222 0
Báo cáo sinh học: "An efficient algorithm to compute marginal posterior genotype probabilities for every member of a pedigree with loops" doc

Báo cáo sinh học: "An efficient algorithm to compute marginal posterior genotype probabilities for every member of a pedigree with loops" doc

... pedigree A nuclear family consists of a set of parents and all their off spring A terminal family is a family that has at most one member who belongs to at least one other nuclear family Terminal members ... probability of individuals A19 and A20 being carriers of the recessive allele (Table 3) While with-out marker data individuals A19 and A20 have a posterior probability of being carriers equal ... C3) 2A(g5,g C4) 1A(g5,g4) Table 2: Marker allele scores for two markers flanking the causative recessive locus. Individual M1A1 M1A2 M2A1 M2A2 Each marker has three alleles coded as 1,2 and 3,

Ngày tải lên: 14/08/2014, 13:21

11 237 0
Study of technical feasibility and the payback period of the invested capital for the installation of a grid connected photovoltaic system at the library of the technological federal university of paraná

Study of technical feasibility and the payback period of the invested capital for the installation of a grid connected photovoltaic system at the library of the technological federal university of paraná

... difference of 5,5% between annual average daily irradiation obtained at the weather station INMET and database SWERA To conclude, this paper considered 5,5% of the annual average daily irradiation ... The authors Year Annual financial return accumulated (RFAC1) (R$) Annual financial return accumulated (RFAC2) (R$) Annual financial return accumulated (RFAC3) (R$) 30 73.295,09 Table 9 Payback ... capital: scenario 1 of energy consumption Source: The authors Year Annual financial return accumulated (RFAC1) (R$) Annual financial return accumulated (RFAC2) (R$) Annual financial return accumulated

Ngày tải lên: 09/09/2015, 10:32

12 431 0
Application of PEEC modeling for the development of a novel multi gigahertz test interface with fine pitch wafer level package

Application of PEEC modeling for the development of a novel multi gigahertz test interface with fine pitch wafer level package

... Trang 1APPLICATION OF PEEC MODELING FOR THE DEVELOPMENT OF A NOVEL MULTI-GIGAHERTZ TEST INTERFACE WITH FINE PITCH WAFER LEVEL PACKAGE JAYASANKER JAYABALAN DEPARTMENT OF ELECTRICAL AND COMPUTER ... discussions and help which have contributed to this work; my IME colleagues Mr Sivakumar and Mr Ranjan for help in test sample preparations I am grateful to my wife Padmalatha, my parents and in-laws for ... 4 J Jayabalan, R Jayaganthan, A.A.O Andrew Tay and B.L Ooi., “Energetics of Copper Nanowires,” International Journal of NanoScience, World Scientific, Singapore, Vol 4, No 4, pp 717-724, Aug

Ngày tải lên: 11/09/2015, 14:24

202 532 0
Proof of the orthogonal measurement conjecture for two states of a qubit

Proof of the orthogonal measurement conjecture for two states of a qubit

... classical states to Bob, but uses states of a quantum system instead How much information do Alice and Bob share? Thisquestion is at the heart of quantum information and a great amount of research ... difference of the auxiliary variables η and ξ2 58 Trang 11Chapter 1Introduction Mutual information measures the amount of classical information that two parties,Alice and Bob, share Shannon showed ... Πjsuchthat the mutual information is equal to the accessible information, i.e Trang 331.2 Quantum States, POVMs and Accessible Information 23and accessible information in the quantum case.Holevo

Ngày tải lên: 14/09/2015, 08:37

100 345 0
AN1299 single shunt three phase current reconstruction algorithm for sensorless FOC of a PMSM

AN1299 single shunt three phase current reconstruction algorithm for sensorless FOC of a PMSM

... sense all three phases Gains and offset will be the same for all measurements, which eliminates the need to calibrate each phase amplification circuit or compensate in software Disadvantages During ... transistorsshown in the three-phase inverter This modulation andresulting modulated waveform are shown in Figure 5 A sinusoidal waveform can be generated by loading aseries of duty cycle values ... to expand the period of time where measurement is taking place This would force a minimum time (critical measuring time) so that current stabilizes to a new value that is actually measurable by

Ngày tải lên: 11/01/2016, 17:06

24 386 0
DSpace at VNU: A robust numerical method for approximating solutions of a model of two-phase flows and its properties

DSpace at VNU: A robust numerical method for approximating solutions of a model of two-phase flows and its properties

... by an equation of state of the form, see[35] ek¼pkþckp1;k whereckand p1;kare constants, k ¼ g; s The system(1.1) and (1.2)has the form of a system of balance laws in nonconservative form A mathematical ... fraction change will always give a stationary contact, we propose todefine a ‘‘relaxation’’ value, which can be seen as an approximate value in general, for the volume fraction an;Relax g;j ¼ max ... (1.2) as a combination of the following three subsystems The firstsubsystem consists of equations of balance laws in the gas phase: Trang 5It has the form of a conservation law with source terms1CA;

Ngày tải lên: 16/12/2017, 08:45

25 181 0
Testing of direct computer mapping for dynamic simulation of a simplified recirculating aquaculture system

Testing of direct computer mapping for dynamic simulation of a simplified recirculating aquaculture system

... Trang 1Hungarian Association of Agricultural Informatics European Federation for Information Technology in Agriculture, Food and the Environment Journal of Agricultural Informatics 2015 ... data for testing of an example fish tank model As a comprehensive data set for testing of the model, we utilized the available empirical data and equations for African catfish (Clarias gariepinus) ... Engineering balogh.sandor@ke.hu 3 Balázs Kucska Kaposvár University, Department of Aquaculture kucska.balazs@ke.hu 4 Yaoguang Wei China Agricultural University weiyaoguang@gmail.com 5 Daoliang

Ngày tải lên: 27/09/2019, 10:31

12 54 0
SIC Interpretation 27: Evaluating the substance of transactions involving the legal form of a lease

SIC Interpretation 27: Evaluating the substance of transactions involving the legal form of a lease

... legal form of a lease are linked to determine whether the transactions are accounted for as one transaction A2 Extreme examples of transactions that are viewed as a whole and accounted for as ... required in accordance with paragraph 10 of this Interpretation shall be provided individually for each arrangement or in aggregate for each class of arrangement A class is a grouping of arrangements ... rating is assessed as AAA and the amounts of the payments under each of the leases are equal Entity A has a legally enforceable right to set-off the amounts owing under each of the leases, and an intention

Ngày tải lên: 05/02/2020, 08:19

10 16 0
A procedure for optimal design of a dynamic vibration absorber installed in the damped primary system based on Taguchi’s method

A procedure for optimal design of a dynamic vibration absorber installed in the damped primary system based on Taguchi’s method

... s a s s a s a a a a a s a a a a (3) Eq (3) denotes a set of linear algebraic equations with two unknowns usand ua It follows that 2 0 0 , , s s a a u F k ic u (4) and 2 0 (5) The formula ... of orthogonal array and calculation of signal-to-noise ratio (SNR) Three levels of each control factor are applied, necessitating the use of an L9 orthogonal array [1, 4] Coding stage 1, stage ... the Taguchi’s method, this paper presents a procedure for designing the optimal parameters of a dynamic vibration absorber attached to a damped primary system The values of the optimal parameters

Ngày tải lên: 03/03/2020, 21:07

13 67 0
Construction of a dense genetic linkage map and mapping quantitative trait loci for economic traits of a doubled haploid population of Pyropia haitanensis (Bangiales, Rhodophyta)

Construction of a dense genetic linkage map and mapping quantitative trait loci for economic traits of a doubled haploid population of Pyropia haitanensis (Bangiales, Rhodophyta)

... with an average value of 97.87 % The largest gap on this map was 7.83 cM in LG5 Visualization and evaluation of the genetic map Haplotype maps and a heat map were used to evaluate the quality of ... restriction-ligation samples, dNTP, Q5® High-Fidelity DNA polymer-ase and PCR primers: AATGATACGGCGACCACCGA and CAAGCAGAAGACGGCATACG (PAGE purified, Life Technologies) The PCR products were purified using Agencourt ... gametophytic blades of each line were mea-sured, and the mean value was calculated by the Microsoft Excel 2010 and was designated as the phenotypic value of each line Quantitative trait locus (QTL) analyses

Ngày tải lên: 26/05/2020, 19:50

11 27 0
Follow-up care after treatment for prostate cancer: Protocol for an evaluation of a nurse-led supported self-management and remote surveillance programme

Follow-up care after treatment for prostate cancer: Protocol for an evaluation of a nurse-led supported self-management and remote surveillance programme

... which has both patient and health care professional facing func-tions Men can access personal information such as treatment summaries and care plans, as well as validated sources of information ... analysis, and interpretation of data nor in writing themanuscript. Availability of data and materials Not applicable. Authors ’ contributions AR is the overall project lead and the grant holder ... disease [34] This evalu-ation of a supported self-management programme for men with prostate cancer will provide useful information for management of this particular group, but will also add

Ngày tải lên: 06/08/2020, 04:07

10 14 0
Policy analysis for improving performance of a construction project by system dynamics modeling

Policy analysis for improving performance of a construction project by system dynamics modeling

... 2.3.4 Factors Affecting Project Performance Time, cost, quality and participant satisfaction are usually main criteria for project success (Dissanayaka and Kumaraswamy, 1999) The three parameters ... incorporate technical, organizational, human and environmental factors System dynamics has been applied practically and/or academically to various issues such as corporate strategy (Sterman, 2000 and ... its dynamic problems and to formulate and evaluate practical policies to improve its performance In order to considerably improve performance and to be able to adapt to different scenarios, six

Ngày tải lên: 17/02/2021, 10:31

160 13 0
w