... inputs, the IV estimators remain consistent but the LS estimators are inconsistent Therefore a Hausman’s specification test can be used to test the null hypothesis of exogeneity The details of the ... and 3372 for the two labor measures 28 respectively) However, the same hypothesis can be rejected for digital dot coms at 5% level Therefore the output elasticity is calculated using the translog ... Under the null hypothesis of exogeneity, both the least squares (LS) and IV estimators are consistent and LS estimators are efficient relative to IV estimators Under the alternative hypothesis of...
Ngày tải lên: 18/02/2014, 11:20
... identified in M truncatula and backcrossed into susceptible cultivars The presence of the resistance gene makes the resistant plant less attractive to aphid infestation The resistance segregates as a single ... levels was presented by Mathesius, while Stacey concluded that abolishing induction of the Bradyrhizobium nod gene in the root environment caused nodulation failure rather than flavonoids having ... populations are maintained in the apical meristem, the growing point of a plant shoot These focused on teasing apart the contributions of individual members of the CLAVATA1 (CLV1), CLAVATA3 (CLV3),...
Ngày tải lên: 14/08/2014, 16:21
Nano product preview march 2009 the applause “ this is a fantastic effort”
... ester is another name for ethyl acetoacetate The "acetoacetic ester synthesis" uses acetoacetic ester as a reactant for the preparation of ketones Dr Wolf's CHM 201 & 202 21-2 Deprotonation of ... CH3CH2O O C C H C OCH2CH3 H Malonic ester is another name for diethyl malonate The "malonic ester synthesis" uses diethyl malonate as a reactant for the preparation of carboxylic acids Dr Wolf's CHM ... 201 & 202 + CO2 Saponification and acidification convert the alkylated derivative to the corresponding β-keto acid The β-keto acid then undergoes decarboxylation to form a ketone 21-8 Example...
Ngày tải lên: 15/03/2014, 22:14
Determinants of Job Satisfaction for Staff at The University of Danang
... engagement for organizations Be the foundation for the organization to increase staff’s loyalty for the University of Danang That’s the reason why research of staff’ s job satisfaction is worth ... development of the organization INTRODUCTION Statement of the Problem (cont’d) Need to get some research data for the director of UD to improve job satisfaction at the UD in the future Create employee ... Development, Information Resources, Continuous Education The English Language Institute INTRODUCTION Statement of the Problem Importance of job satisfaction Importance of job satisfaction at The University...
Ngày tải lên: 18/04/2014, 16:25
báo cáo sinh học:" Human resources for health at the district level in Indonesia: the smoke and mirrors of decentralization" ppt
... important alternate source of care [14,15] The situation is further complicated by the fact that the government has inadequate information about the stock of health care providers at the district level, ... service status of these health care providers at the district level? • What is the primary place of work of these health care providers at the district level? • What was the effect of decentralization ... primary place of work The aggregate information on employment status and primary place of work for the districts in these provinces is based on information available in the annual district health sector...
Ngày tải lên: 18/06/2014, 17:20
how to act like a ceo 10 rules for getting to the top and staying there phần 5 ppt
... envision the end-state The ‘what’ to be solved Then leave the ‘how’ up to them That way they own the execution,” says Al Yasalonis, Nabisco Logistics Operations Frankly, the majority (that may ... THE BIG PLAY The CEO’s role in operations is to: TE Delegate Communicate Plan for the mistakes Don’t let the desire to control everything get in the way of doing what you’re best at Give up the ... and this was a “thank you” celebration for the people involved The CEO placed a $20 bill on the floor in the center of the group and said, “Tell us the mistakes made in this project and the best...
Ngày tải lên: 10/08/2014, 07:21
how to act like a ceo 10 rules for getting to the top and staying there phần 6 docx
... people feel they are changing the world That’s what really matters to them They want to look at themselves in the mirror with satisfaction And they want to be able to talk to people at cocktail ... Warren’s appreciation of his people made them heroes at the office and at home when their quotes showed up in the paper Simply asking someone’s opinion is praise Knowing that the top dog” thinks ... from three basic misconceptions,” says psychiatrist, Dr Albert Ellis “They believe they must well; that other people must treat them kindly, nobly and their bidding; and that conditions must...
Ngày tải lên: 10/08/2014, 07:21
how to act like a ceo 10 rules for getting to the top and staying there phần 7 ppt
... Nimish Mehta CEO, Impresse The CEO is the ‘form,’ the CFO the ‘substance.’ That is not meant as a dig on the CEO or a pat on the back of the CFO It’s just that the CFO is the reflection of the ... guarantee, you’ll lose them First of all, they just won’t take it; second, there is a ton of options for good ones; third, a lot of them have all the money they need so they what they for the passion and ... strategy The person must have outstanding technical skills so that financial statements accurately reflect the performance of the company (The reflection of the results tells you “what.” The...
Ngày tải lên: 10/08/2014, 07:21
how to act like a ceo 10 rules for getting to the top and staying there phần 8 ppt
... about self-sabotage! Other parts of the body assist the speaker but the hands speak themselves By them we ask, promise, invoke, dismiss, threaten, entreat, deprecate By them we express fear, ... start the day’s dictation That pace continues all day and you get home at or p.m at night Most all of the weekend is spent on business phone calls And then there are the pajama meetings at a.m for ... selling, “They call it coaching but it is teaching You not just tell them it is so, but you show them the reasons that it is so, and you repeat and repeat until they are convinced, until they know.”...
Ngày tải lên: 10/08/2014, 07:21
how to act like a ceo 10 rules for getting to the top and staying there phần 9 pps
... these characteristics make up a good member so this is what you need to be offering the charitable (and corporate) boards: Experience Dedication and attentiveness Ability to help the organization ... involvement for the prestige of the association or join boards for the contacts where there are other CEOs they want to be around And the sole purpose for getting involved shouldn’t be for potential ... Your first obligation is to the company That’s what you get paid for The CEO’s job is to create value for owners In fact, many say you shouldn’t involve yourself with any activity that infringes...
Ngày tải lên: 10/08/2014, 07:21
how to act like a ceo 10 rules for getting to the top and staying there phần 10 pot
... being is valued Young, successful, and arrogant is tolerated only as long as you are needed “I feel sorry for people who didn’t climb to the top but jumped there They miss so much They miss the ... if they want to participate in the real world they’ll need to know those skills,” says John Bianchi, CEO of Frontier Gunleather That’s one of the reasons for writing this book To avoid that If ... started his theory of space-time relativity at age 26 Samuel Colt patented the first revolver at 21 Ludwig van Beethoven published his Opus I by age 23 Petr Tchaikovsky completed his opera Undine at...
Ngày tải lên: 10/08/2014, 07:21
Taming organisational complexity start at the top
... Due to the limited base size, this data should be viewed as directional in nature 17 © The Economist Intelligence Unit Limited 2015 Taming organisational complexity—start at the top What is the ... as their companies require unless they are truly desperate Taming organisational complexity—start at the top Conclusion Embracing the fight Experts and the survey data suggest that not only is ... executives, many of them are frustrated by the symptoms of complexity They feel and they worry there is this underlying root cause that’s creating it, but they struggle to put their finger on it,”...
Ngày tải lên: 06/12/2015, 23:14
32907 english for tourism at the hotel reception
... Type) Configuration) Adults and Children Room Adults Children (Room (Room Type) Configuration) Write and role-play the following conversation At the Rainbow Hotel A lady phones the Rainbow ... reservation She can choose a single or double room, with or without breakfast, smoking or non-smoking The receptionist asks the lady how many nights she wants to stay at the hotel Finally, the ... she wants to stay at the hotel Finally, the clerk asks the lady to spell her name, and then asks for her credit card number and expiration date ...
Ngày tải lên: 28/08/2016, 10:04
Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx
... to reach the exponential 5444 This This This This This This This This This This This This This study study study study study study study study study study study study study This study This study ... SGA1_R ATH1_suc2 ATH1_pep4 ATH1_pLC1 ATGATGATGATAACAAAGGAGCTACAATCAAGGAAATTGTTCTCAATGATCGGATCCCCGGGTTAATTAA ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAAC GCACTAGTATGAAAAGAATAAGATCGCTTT ... GGATCCATCATGTTCTCATCATCATAATATG GGATCCGTTAAATATAATGCAGTGACGAAGATA GGATCCAAGTCAAACCTTGAGAAAGAACGA CACGGCATATTATGATGATGAGAACATGATGGATCTCG CGCGGATCCCCGGGTTAATTAA TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAAC...
Ngày tải lên: 18/02/2014, 06:20