... Hepatitis C virus all need to be elucidated Conflict of interest The authors have declared that no conflict of interest exists References WHO Global surveillance and control of hepatitis C Report of ... Chavez-Tapia NC, Bahena J, Correa-Rotter R, Uribe M Prevalence of Hepatitis C virus infection among hemodialysis patients at a tertiary-care hospital in Mexico City, Mexico Journal of Clinical Microbiology, ... Vincelette J, Lavoie R, Turmel B, Remis RS Lack of evidence of sexual transmission of hepatitis C virus in a prospective cohort study of men who have sex with men American Journal of Public Health...
Ngày tải lên: 02/11/2012, 09:56
... estimated 10%20% of chronic HCV infections advance to end-stage liver disease over one or two decades Extrahepatic manifestations can occur during chronic HCV infection or cirrhosis, but HCC appears ... and/or hepatocellular carcinoma.[3] 50 Summary The chronic nature of hepatitis C infection influences the clinical approach and management of this disease Prevention of the HCV infection is possible ... 90% of HCV infections after the initial months Chronic Hepatitis C Chronic hepatitis C is marked by the persistence of HCV RNA in the blood for at least months after onset of acute infection HCV...
Ngày tải lên: 02/11/2012, 09:56
Báo cáo y học: "Molecular Virology of Hepatitis C Virus (HCV): 2006 Update"
... J Med Sci 2006, 30 Figure Life cycle of HCV The steps of the viral life cycle are depicted schematically The topology of HCV structural and nonstructural proteins at the endoplasmic reticulum ... transfection into the human HCC cell line Huh-7 G418 resistant colonies contain selfreplicating HCV RNA Critical for the usefulness of this system was the identification of specific amino acid substitutions, ... bicistronic and monocistronic replicon constructs including subgenomic and full-length HCV sequences is depicted schematically Stably replicating systems are equipped among others with a neomycin...
Ngày tải lên: 02/11/2012, 10:00
A Quick Tour of the C++CLI Language Features
... You could compile the class unchanged in C+ +/CLI with the following command line: cl /clr atom.cpp and it would be a valid C+ +/CLI program That’s because C+ +/CLI is a superset of C+ +, so any C+ + ... dynamic_cast), we use a casting construct that is introduced in C+ +/CLI, safe_cast A safe cast is a cast in which there is, if needed, a runtime check for validity Actually, there is no check to ... an atom decays property DecayProcessFunc^ DecayProcess; }; // ref class RadioactiveAtom Hogenson_705- 2C0 2.fm Page 25 Friday, October 13, 2006 2:14 PM CHAPTER ■ A QUICK TOUR OF THE C+ +/CLI LANGUAGE...
Ngày tải lên: 05/10/2013, 08:20
Tài liệu Báo cáo khoa học: Structural features of proinsulin C-peptide oligomeric and amyloid states pptx
... scattering, electron microscopy, MS, gel electrophoresis and a wide range of spectroscopic techniques Suitable methods for investigation of the secondary structure and morphology of such structures, ... that low concentrations of SDS have the ability to mimic the necessary conditions for the formation of aggregated species, whereas higher concentrations [well above the critical micelle concentration ... which only small species can be detected, the monomer state cannot be discerned by light scattering in the presence of the much larger oligomer complexes because of the strong size dependency of...
Ngày tải lên: 18/02/2014, 04:20
Tài liệu Báo cáo khoa học: Seed-based systematic discovery of specific transcription factor target genes pptx
... (5¢-ACTACGCGTAGTCCAAGAGAGGAGAAACC-3¢) and DARSrv (5¢-ACTCTCGAGCCCGGAGCGCTGGCG GCCGC-3¢), and NFKBIAfw (5¢-ACTGAGCTCCCGA CGACCCCAATTCAAATCG-3¢) and NFKBIArv (5¢-ACT GAAGCTTTGTGGGCTCTGCAGCGCCGC-3¢) The SPI-B and CASP constructs ... 5¢-ACCCCAGCTCAGGGTTTAGGCTTCT-3¢; NFKBIA reverse, 5¢-TGGCTGGGGATTTCTCTGGG-3¢; OPTN forward, 5¢-ACCCGGGTCCCAGCCTCGAC-3¢; OPTN reverse, 5¢-GACAGCCAGCCGCTCCCTGC-3¢; SPI-B forward, 5¢-TCCAGCTCCTGTCCCATCTC-3¢; SPI-B ... primers CASP4fw (5¢-ACT ACGCGTAGCAAAGAGTGCTGCCTCCTCCTTCCT-3¢) and CASP4rv (5¢-ACTCTCGAGTTCCCTGGTACAGAG CACCT-3¢) The predicted NF-jB-binding site gggggaa tcccc in the CASP4 construct and the predicted...
Ngày tải lên: 18/02/2014, 18:20
Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx
... the structure of the A state of cytochrome c Biochemistry 39, 12632– 12638 18 Sinibaldi F, Howes BD, Smulevich G, Ciaccio C, Coletta M & Santucci R (2003) Anion concentration modulates conformation ... particular, both perchlor 5350 Fig Effect of perchlorate (d) and chloride (s) concentration on the heme pocket environment of the sulfate-induced A-state of cytochrome c, as observed from changes ... horse cytochrome c The expression plasmid of horse cytochrome c was introduced into Escherichia coli JM 109 strain; bacterial expression and purification of the recombinant protein were then conducted...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Insulin-dependent phosphorylation of DPP IV in liver Evidence for a role of compartmentalized c-Src ppt
... regulatory processes including chemokine regulation [19] and maintenance of physiological glucose homeostasis [20] Knockout mice lacking the gene for DPP IV show enhanced insulin secretion and accelerated ... known translocation motifs in c- Src, and the mechanism of c- Src translocation is yet to be characterized However, the dynamic role of the translocons [54,55] and membrane restructuring enzymes ... Enhanced insulin secretion and improved glucose tolerance in mice lacking CD26 Proc Natl Acad Sci USA 97, 6874–6879 22 Pauly RP, Demuth HU, Rosche F, Schmidt J, White HA, Lynn F, McIntosh CH &...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: Glucuronate, the precursor of vitamin C, is directly formed from UDP-glucuronate in liver pptx
... Belgian Science Policy; and the Fonds de la Recherche ´ Scientifique Medicale CLL is a fellow of the Fonds National de la Recherche Scientifique (FNRS) References Smirnoff N (2001) l-Ascorbic acid biosynthesis ... involves conversion of UDP-glucuronate to UMP in the lumen of the vesicles and exchange of the latter with cytosolic UDPGlcNAc Once inside microsomes, the latter can, in turn, be exchanged with cytosolic ... presence of sorbinil, an inhibitor of aldose reductase and aldehyde reductase [9], to block the conversion of glucuronate to l-gulonate, and in the presence of UDP-N-acetylglucosamine (UDPGlcNAc),...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx
... immunocompetent mice infected with CVB3 [67,109] In the immunodeficient mice, the CVB3 infection led to chronic myocarditis characterized by marked cell infiltration to the myocardium, and necrosis of ... when prostate cancer was induced in mice, revealing a remarkable increase in contact between the prostate carcinoma cells and the stromal cells, which is critical for prostate cancer progression ... suggest a role for the PDGF -C in the development of lung fibrosis One of the characteristics of pancreatic cancer is the overproduction of extracellular matrix by interstitial cells This results in...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: Unfolding of human proinsulin Intermediates and possible role of its C-peptide in folding/unfolding pptx
... reaction was stopped by addition of trifluoroacetic acid RP-HPLC was used to measure the amount of HPI that had been reduced We found that the lowest concentration of dithiothreitol capable of completely ... protein concentration of HPI and the disulfide isomers were calculated by UV spectroscope using an absorption constant A276 (1 cm, 1.0 mg mL)1) ¼ 0.65 according to the reference [36] The molecular ... procedures Materials Recombinant HPI and PIP were of > 98% purity as confirmed by RP-HPLC on a C8 column Endoproteinase Lys -C and V8 were of sequencing grade (Sigma) The sodium salt of iodoacetic...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: Rotary F1-ATPase Is the C-terminus of subunit c fixed or mobile? docx
... the Ca atoms of cK18, cI19, cT20 and cK21, and the second group Ca atoms of cD233, cN234, cA235 and cS236 The magnitude and direction of the forces was calculated at every step of the molecular ... from the N-end of c subunit (cA1–cK24) and 43 residues from its C- end (cT230– cL272) The chosen portion included a major part of the coiled-coil region of c and the complete a-helical C- terminus ... the coiled-coil portion of c at the level of cK18–cK21 and cD233–cS236 residues The torque was created by external forces acting on the two groups of four carbon atoms each The first group included...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
... CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA ... GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT ... TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT AGCCATGGTTT AAACCATGGCTAGAATTCATGGTGGAGTGTCGCCCCCATCAGGGGGCTGGC GCGGCCGCAAA GGCTGCACGACACTCCGCCATGGCTAGACGCTTTC CGTCTAGCCATGGCGGAGTGTCGTGCAGCCTCCAGG CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx
... of CytOX V [10,32] The regulation of genes CytOX5a and CytOX5b, coding for the two isofoms Va and Vb, parallels that of genes CYC1 and CYC7, which encode iso-1 and iso-2 of yeast cytochrome c, ... ribonucleic acid in vitro in mitochondria from Ehrlich ascites cells Biochemistry 22, 3151–3156 20 Smith, L (1955) Spectrophotometric assay of cytochrome c oxidase In Methods in Biochemical Analysis ... formation of the more active dimeric complex As heme is involved in reactions that transfer electrons from cytochrome c to molecular oxygen, its depletion reflects alterations in the catalytic efficiency...
Ngày tải lên: 20/02/2014, 23:20
Tài liệu Báo cáo khoa học: The kinetic properties of various R258 mutants of deacetoxycephalosporin C synthase doc
... sequence R258K R258H R258A R258Q [17] R258L R258F 5¢-ACTGGAGGTCTTGCTGCTGC-3¢ 5¢-ACTGGAGGTGTGGCTGCTGC-3¢ 5¢-ACTGGAGGTCGCGCTGCTGC-3¢ 5¢-ACTGGAGGTCTGGCTGCTGC-3¢ 5¢-ACTGGAGGTCAGGCTGCTGC-3¢ 5¢-ACTGGAGGTGAAGCTGCTGC-3¢ ... Biotechnology and Biological Sciences Research Council, Engineering and Physical Sciences Research Council, Medical Research Council, the Wellcome Trust, the European Union and the National Science ... Scheme Conversion of penicillin G to G-7-ADCA and ampicillin to cephalexin by DAOCS of activity in the presence of penicillin and ampicillin, presumably due to maintenance of a charge interaction...
Ngày tải lên: 20/02/2014, 23:20
Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt
... NapC_Rsph CymA_Sput NrfH_Ddes NrfH_Sdel NrfH_Wsuc Cytc_Dgig Cytc_Ddes 110 L ECRNCHNF E L ECRNCHSAE L ECRNCHAAV L ECRNCHSEV ANCQHCHT RI ANCKACHT QT CI S CHQS L CI SCHASL CHNI L CHANT ... Structural and functional approach toward a classification of the complex cytochrome c system found in sulfate-reducing bacteria Biochim Biophys Acta 1058, 61–66 Ó FEBS 2003 Characterization of ccNiR ... considering that ccNiR samples comprise Ó FEBS 2003 Characterization of ccNiR subunits (Eur J Biochem 270) 3911 ă Fig Mossbauer spectra of D desulfuricans ATCC 27774 ccNiR native complex (pH 7.6)...
Ngày tải lên: 21/02/2014, 00:20
The analysis of vitamin c
... I2 concentration begins to go up and the reaction with the indicator occurs: I (aq) + starch ⎯ starch − I (complex) ⎯→ yellow blue Because an I2 solution cannot be prepared accurately by direct ... 3‐4 C Data and Calculations C- 1 Standardization of Iodine Solution Sample Mass of Ascorbic Acid Sample (g) Moles of Ascorbic Acid Initial buret reading (mL) Final buret reading (mL) Volume of ... bottom of the meniscus), add mL of starch indicator to the first ascorbic acid sample and titrate with the iodine solution Note the change of the I2 color as you swirl the flask gently and continuously...
Ngày tải lên: 03/03/2014, 11:49
Báo cáo khoa học: Heterologous synthesis of cytochrome c¢ by Escherichia coli is not dependent on the System I cytochrome c biogenesis machinery ppt
... reference to PH c5 52, which has been characterized as a System I-dependent cytochrome c Biogenesis of cytochrome c Heterologous synthesis of PHCP by E coli The E coli System I cytochrome c biogenesis ... (1996) Alteration of haem-attachment and signal-cleavage sites for Paracoccus denitrificans cytochrome c5 50 probe pathway of c- type cytochrome biogenesis in Escherichia coli Mol Microbiol 19, 1193–1204 ... pKK223-3 The E coli JCB387 strain was further co-transformed with pEC86 [29], which carries the E coli cytochrome c maturation genes ccmABCDEFGH (chloramphenicol resistance) The transformed E coli RI89,...
Ngày tải lên: 06/03/2014, 00:20