... published material available on a particular research topic in APA-referencing format with 800-1,000 words. •summarizes, synthesizes and evaluates the ideas of other scholars on that research topic ... University Writing Center. 1 describing your research question and the type of data you used in answering it, 2 explaining your process of data collection 3 elaborating on data analysis 4 justifying ... Research Papers San José State University Writing Center. 6 Quantitative Research Results/Findings: EXAMPLE #1 (Ammon, 2022) Trang 336 Quantitative Research Results/Findings: EXAMPLE #1 (Ammon,
Ngày tải lên: 07/04/2024, 20:35
... indicate, and that appropriate credit is given where I have Trang 5 ABSTRACT THE AWARENESS OF UNDERGRADUATE AND GRADUATE ACCOUNTING STUDENTS TO ETHICAL ISSUES IN INTERNAL AUDITING By Ana Margarita ... Trang 1 THE AWARENESS OF UNDERGRADUATE AND GRADUATE ACCOUNTING STUDENTS TO ETHICAL ISSUES IN INTERNAL AUDITING By Ana Margarita Cruz A DISSERTATION Submitted to H Wayne Huizenga School of Business ... file, in its annual report, an internal control report of management stating: management’s responsibilities for establishing and maintaining adequate internal controls and procedures for financial
Ngày tải lên: 30/03/2014, 01:20
A Research Paper Submitted In Partial Fulfillment Of The Requirements For The Master Of Science Degree In Career And Technical Education
... Combination of above My "most" effective learning is achieved through: a Seeing and hearing about b Reading about c Hearing about d Doing I Hands-on Technology enhances my learning: a Strongly agree ... mismatch of teaching/learning styles is a factor in determining student success in the accounting program at Chippewa Valley Technical College Statement of Problem In the accounting education ... Stanford, 2003) Another popular theory was proposed in 1991 by Dr Richard Felder and Barbara Soloman of North Carolina University Felder and Soloman's theory was that intelligence can be allocated
Ngày tải lên: 10/12/2016, 15:29
Ethical issues in responding to climate change a comparative studies between lagos city, nigeria and hanoi city, vietnam
... Trang 1VIETNAM NATIONAL UNIVERSITY, HANOI VIETNAM JAPAN UNIVERSITY AZU ANTHONY ANWANI ETHICAL ISSUES IN RESPONDING TO CLIMATE CHANGE: A COMPARATIVE STUDIES BETWEEN LAGOS CITY, NIGERIA AND HANOI ... uncertain and highly politicized context within which any international and national actions are taken in efforts to mitigate climate change and adapt to its effects, and Noting its mandate to advise ... Ordinary Session of COMEST in Doha, Qatar 2011 Having considered the Trang 27far‐ reaching global changes that would follow from unmitigated climate change whatever its causes, and Taking into account
Ngày tải lên: 24/12/2020, 22:40
Ethical issues in responding to climate change: a comparative studies between Lagos city, nigeria and Hanoi city, Vietnam
... Trang 1VIETNAM NATIONAL UNIVERSITY, HANOI VIETNAM JAPAN UNIVERSITY AZU ANTHONY ANWANI ETHICAL ISSUES IN RESPONDING TO CLIMATE CHANGE: A COMPARATIVE STUDIES BETWEEN LAGOS CITY, NIGERIA AND HANOI ... uncertain and highly politicized context within which any international and national actions are taken in efforts to mitigate climate change and adapt to its effects, and Noting its mandate to advise ... Ordinary Session of COMEST in Doha, Qatar 2011 Having considered the Trang 27far‐ reaching global changes that would follow from unmitigated climate change whatever its causes, and Taking into account
Ngày tải lên: 27/01/2021, 06:26
Subject writing a term paper methods to reduce plastic pollution in educational spaces
... speakers and workshops in enhancing educational initiatives 5 Challenges and Limitations Financial constraints and lack of resources Resistance to change ingrained habits regarding plastic ... concentrations in the human gastrointestinal https://www.researchgate.net/publication/356626663_Microplastic_Contamination_in_the_Human _Gastrointestinal_Tract_and_Daily_Consumables_Associated_with_an_Indonesian_Farming_Com ... insights and inspiring them to take action Therefore, promoting environmental awareness and reducing plastic waste in educational settings requires a multifaceted approach that combines early education,
Ngày tải lên: 11/02/2025, 16:14
ethical issues in molecular medicine and gene therapy
... as raising ethical issues Why does David’s death raise ethical issues? Why would David’s case have raised ethical issues even if he had survived? And what precisely are the issues that are raised? ... too stark and too unfair Someone might care to see David as a medical hero in a battle against diseases that afflict mankind After all, the argument goes, adolescents who are only a few years older ... what we are morally obligated to as a society is to put in place a truly national health care insurance mechanism: universal access to a fairly thick package of health benefits If, as is arguable,
Ngày tải lên: 10/04/2014, 22:10
báo cáo khoa học: " Human subjects protection issues in QUERI implementation research: QUERI Series" pptx
... chaney@u.washington.edu; Laura G Rabuck - Laura.Rabuck@va.gov; Jane Uman - Jane.Uman@va.gov; Deborah C Mittman - Debbie.Mittman@va.gov; Carol Simons - Carol.Simons@va.gov; Barbara F Simon - Barbara.Simon@va.gov; ... As the number of sites increased across projects, it became clear that a relational database was necessary to efficiently track all the paperwork and deadlines Using Microsoft ACCESS, information ... trial COVES Mixed method; administrative data analysis and qualitative interviews ReTIDES Regional demonstration project with program evaluation ᭜ Primary care, mental health, nursing and administrative
Ngày tải lên: 11/08/2014, 05:22
Linguistic errors in writing a paragraph of 10th form students at Nguyen Trai high school in Hai Phong and some solutions = Những lỗi về ngôn ngữ khi viết đoạn
... get a writing assignment, and many writing exercises in the textbook are abandoned Besides that, teachers are also afraid of teaching writing skill They think that teaching writing is really a ... Writing I.1.1 Reasons for teaching writing I.1.2 Principles of teaching writing I.2 Teaching paragraph writing I.2.1 Definitions of Paragraph I.2.2 Classifications of paragraph I.3 Writing ... their weaknesses in writing a paragraph and they were aware of the linguistic errors they often make when writing III 2 Students’ feeling when making errors in writing Trang 12After making errors
Ngày tải lên: 28/03/2015, 10:42
“AN INVESTIGATION ON SOME COMMON PROBLEMS IN WRITING A LETTER WITH GIVEN TITLE OF NON- MAJORED STUDENTS AT TAY NGUYEN UNIVERSITY
... speaking, reading and writing Writing skills are an important part of communication Good writing skills allow you to communicate your message with clarity and ease to a far larger audience than through ... Phuong, MA to help mark and comment on the papers - To collect data of mistakes students that students usually make in writing practice tests 3.4 Research methods Main method: Writing practice ... if candidates write in upper or lower case, or if their writing is joined up or not It is also important that candidates realise that Writing Part carries 15 marks out of the total of 25 It takes
Ngày tải lên: 05/09/2016, 08:29
Ethical Issues in Pharmacogenomics
... physicians have an ethical obligation to advise patients that these drugs are available, even though the patient would have to pay in cash? Trang 31Pharmacogenomics will result in an increase in ... warnings to the consumer?Are product labels, package inserts, or other types of warnings sufficient? Is there a danger in having too many warnings? Trang 122 LEARNED INTERMEDIARYCan a manufacturer ... trials Warnings Marketing MANUFACTURER RESPONSIBILITIES Trang 10Class action lawsuit alleging that manufacturer of vaccine for Lyme disease (Lymerix) failed to warn that some individuals, based
Ngày tải lên: 05/12/2016, 15:50
Radioactivity in the environment chapter 7 ethical issues in clinical radiology
... from inadequate training It can also include insufficient knowledge of the patient presenting, foregoing clinical examination in favor of imaging, duplicating examinations already undertaken, inadequate ... provides an abstract generally applicable approach using categories and terminology frequently employed in ethical analysis of an action The generality of the approach has the advantage of avoiding ... and ethical behavior are, as we have seen, many faceted There are many areas of radiology in need of attention from an ethical point of view The clinical discipline would gain from embracing basic
Ngày tải lên: 03/01/2018, 17:48
Radioactivity in the environment chapter 19 compensation or bribery ethical issues in relation to radwaste host communities
... identify appropriate compensation But a preliminary set of ethical issues can already be identified Describing something as a negative impact involves making a value judgment: in describing the thing ... that radioactive waste remains potentially dangerous to human and nonhuman life for many thousands of years, there can, arguably, be no clear right answer An awareness that all options have ethical ... from an inhabitant of the Narmada Valley in Western India, threatened with displacement as a result of the Sardar Sarovar Dam 368 PART | V Public Participation You tell us to take compensation
Ngày tải lên: 03/01/2018, 17:49
Some issues in data mining research Một số vấn đề trong nghiên cứu về khai phá dữ liệu - Hồ Tú Bảo
... 864 AAATTGTGGAATGTGTATGCTCATAGCACTGAGTGAAAATAAAAGATTGT ||| | ||| || || ||| | ||||||||| || |||||| | 173 AAA.TATGGGATATGCATGTCGA CACTGAGTG AAGGCAAGATTAT 813 135 863 172 913 216 Expression analysis ... ||| 87 TTGACAGGTACCCAACTGTGTGTGCTGATGTA.TTGCTGGCCAAGGACTG 814 AGTGTTTGAGCCTCTGTTTGTGTGTAATTGAGTGTGCATGTGTGGGAGTG | | | | |||||| | |||| | || | | 136 AAGGATC TCAGTAATTAATCATGCACCTATGTGGCGG ... discriminates class A+ from class A- (binary classifier) Idea: The best learning can be achieved with the surface that maximizes “margin” determined by “support vectors” Data that are non-separable
Ngày tải lên: 11/06/2018, 16:56
HIV in pregnancy - ethical issues in screening and therapeutic research
... rising (de Cock and 71HIV in pregnancy 4 HIV in pregnancy: ethical issues in screening and therapeutic research Paquita de Zulueta Department of Primary Healthcare and General Practice, Imperial ... conWdentiality issues ‘must be strictly maintained’ (UK Intercollegiate Working Party, 1998) and that ante- natal clinics must have in place a conWdentiality policy, particularly as obstetric notes are hand-held ... The latter may mean literally nothing in many cases. This proposed interpretation represents more than a mere tinkering at the edges, but a fundamental change. Yet again we see an abrogation...
Ngày tải lên: 01/11/2013, 08:20
Cambridge.University.Press.Ethical.Issues.in.Maternal-Fetal.Medicine.Mar.2002.pdf
... still maintain: ‘It does seem reasonable to argue that as long as an individual does not have a life so blighted by suVering that it outweighs any pleasure gained by living, that individual has not ... imposing an invasive treatment upon a mentally compet- ent pregnant woman against her wishes. Her having a moral standing greater than that of the fetus does not logically entail that forced treatment ... Priscilla Alderson, Christine Overall, and Rebecca Bennett and John Harris. Neil McIntosh (Chapter 21), a consultant paediatrician in Scotland, oVers a practising clinician’s slant on disability, in...
Ngày tải lên: 21/09/2012, 10:54
Writing a research thesis
... site, participants, data gathering and analysis. ã It may include illustrations (eg, a timeline depicting stages/steps in the research) . In minor theses, this section may appear in the Introduction. ... Discussion ã Discusses findings, drawing out main achievements and explaining results. ã Makes links between aims, and findings (and the literature). ã May make recommendations these could appear in the Conclusion ... taken to ensure ethical research practice (shows you are a serious researcher who takes account of how research may affect participants). Chapter IV : Results ã Presents the data and findings,...
Ngày tải lên: 15/10/2013, 01:11
Ethical issues in embryo interventions and cloning
... compared to other forms of prenatal testing already in place in many countries. The speciWc ethical problems of pre-implantation diagnosis are also linked to its particular constraints, especially ... any less a part of human society? Can we not argue instead that the best way to counteract discrimination is to accept diVerence as a valuable addition to the rich tapestry of life rather than ... vitro phase, i.e. as a research tool, as in the possible development of stem cell cultures for repairing organs. As all research, the objective is essential in analysing the ethical quality. The...
Ngày tải lên: 01/11/2013, 08:20
Ethical issues in withdrawing life-sustaining treatment from handicapped neonates
... observation will reveal abnormalities of the genitalia and anal region, and, in this example, there would be severe gastrointestinal abnormalities and renal agenesis making death inevitable from ... examination. In many cases extra information will become available at an autopsy which was not known during life, and it is not infrequent for this additional information to aid counselling and ... be repeated and severe problems and invasive therapy, parents may feel that treatment 33 9Ethical issues in withdrawing life-sustaining treatment and Withholding Treatment. London: St Mary’s NHS...
Ngày tải lên: 01/11/2013, 08:20
The fewer the better. Ethical issues in multiple gestation
... by pointing to the fetuses that are terminated rather than those that may be saved. Although egalitarian feminists do not regard potential persons as equal in value to actual persons, many acknowledge ... (1989). Maternal Thinking: Towards a Politics of Peace. New York: Ballantine Books. Sen, A. (1995). Inequality Reexamined. Cambridge, MA: Harvard University Press. Silvers, A. , Wasserman, D. and Mahowald, ... their intended oVspring are beneWcent or non-maleWcent, and in some cases altruistic, rather than discriminatory. Cases 1a d and 2a e are similar in that they involve relatively minor medical risks...
Ngày tải lên: 01/11/2013, 08:20