... 8-58 Deploying a Stub Zone 8-69 Deploying Role- Based Security Using Group Policy 9-30 Security Templates ... 9-23 Lesson 2: Deploying Security Configuration with Group Policy Objects 9-24 Applying a Baseline Security Configuration 9-24 Applying Role- Based Security Configurations ... Software Deployed with Group Policy 6-62 Redeploying Applications Deployed with Group Policy 6-62 Upgrading Applications Deployed with Group Policy ...
Ngày tải lên: 01/06/2014, 09:32
... phosphorylation could also be mediated by the p38 kinase when using endogenous kinase activity To overcome this possibility and to confirm the role of JNK, we transfected Jurkat cells with exogenous ... limited, and is related Ó FEBS 2002 mostly to their role as costimulatory molecules CD53, like other tetraspanin antigens, has a costimulatory role in different cellular systems CD9, CD81, CD82 ... physical CD53–protein interaction on the membrane, thus expanding its role as a costimulatory molecule In this context, the role of CD53 as a stimulator of JNK activation might be important for...
Ngày tải lên: 08/03/2014, 22:20
Báo cáo khoa học: Differing molecular mechanisms appear to underlie early toxicity of prefibrillar HypF-N aggregates to different cell types potx
... resistant to HypF-N toxic aggregates, respectively [14] Our analysis was carried out using a highly sensitive test based on Resazurin reduction by mitochondrial oxidoreductases A significant early ... damage The cytotoxicity of the HypF-N aggregates was assessed using the CellTiter-Blueä Cell Viability Assay (Promega, Milan, Italy) based on the reduction of the indicator dye Resazurin into Resurfin ... PAGE gels using anti-(Bcl-2) monoclonal sera (Santa Cruz Biotechnology, San Diego, CA) The cytosolic fractions of cytochrome c (16 kDa) were quantified in blots of 15% SDS ⁄ PAGE gels by using mouse...
Ngày tải lên: 16/03/2014, 13:20
Báo cáo hóa học: " Nano-structure fabrication of GaAs using AFM tip-induced local oxidation method: different doping types and plane orientations" ppt
... mechanical properties in nanometer scale using AFM -based nanoindentation tester Nano Structured Materials 1999, 12:1049-1052 Langehanenberg P, Bally G, Kemper B: Autofocusing in digital holographic microscopy ... were performed by using COMSOL Multiphysics software (FEMLAB, Burlington, MA, USA) Results and discussion The mechanism of local oxidation on the GaAs surface by contact mode AFM using Pt-coated ... S, Teichert C, Kuchar F, Hofer H: Modification and characterization of thin silicon gate oxides using conducting atomic force microscopy Mater Sci Eng B 2003, 102:88 García R, Calleja M, Rohrer...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo y học: " Sociodemographic and occupational risk factors associated with the development of different burnout types: the cross-sectional University of Zaragoza study" docx
... characteristics The TRS group included subjects with higher qualifications and higher income (p < 0.001) The ASP group had the lowest number of work hours per week (p < 0.001) The TRA group was clearly ... our study, the ASP group had a greater likelihood of developing this burnout profile when compared to the TRS group Burnout can generally occur in all types of occupational groups [50], but public ... multivariate analysis for this profile Specifically, the ASP group had a greater likelihood of having a high score than did the TRS group (adjusted OR = 2.85; 95% CI = 1.16-7.01), as did males...
Ngày tải lên: 11/08/2014, 15:22
Báo cáo y học: "Blateral synchronous occurrence of three different histological types of renal tumor: a case report" docx
... incidentally during routine ultrasound examination and the discrimination between RCC and oncocytoma based solely on radiologic criteria, including CT and/or MRI, is not always possible Therefore,...
Ngày tải lên: 11/08/2014, 17:21
báo cáo khoa học: " ''''Who''''s who'''' in two different flower types of Calluna vulgaris (Ericaceae): morphological and molecular analyses of flower organ identity" pdf
... or petals are absent [5,11] Moreover, no explanation is given for the grouping of the sepals into two whorls and for the grouping of stamen in two whorls [5,8] Furthermore, the described classification ... opened, mature flowers of each type, using SGL instead of FCA staining (Fig 7) Estimation of the genome size The genome size of C vulgaris was estimated by laserbased flowcytometry since the knowledge ... was isolated using a modified protocol of the RNeasy Plant Mini Kit ([37], Qiagen) and subsequently reverse transcribed to first strand cDNA (Reverse Transcription System, Promega) using a standard...
Ngày tải lên: 12/08/2014, 03:21
SÁNG KIẾN KINH NGHIỆM Improving High School Students Reading Skills Through Using Different Question Types
... Teaching Grammar in Context - Using Barrett’s Taxonomy to Enhance High School Students’ Reading Comprehension - Improving High School Students’ Speaking Skill Through Role- play - Improving Grade ... schools to have new policy in teaching and learning English and assessing the students’ communicative competence required by the Misnistry of Education and Training The study on using different qustion ... Vietnam must be assessed with the four language skills : listening, speaking, reading and writing based on students’ communicative competence Most of the teachers in Dong Nai Province are aware...
Ngày tải lên: 17/07/2015, 20:39
different finishing types
... travelling on tracks Mechanical Finishing Raising Napping Using wire-covered rolls to "dig out" individual fiber ends to the surface Sueding Using abrasive-covered rolls (sandpaper, emery cloth,...
Ngày tải lên: 30/07/2015, 10:32
Tài liệu HOW TO HANDLE DIFFERENT TYPES OF RETAIL SHOPPERS AND MAKE SHOPPING A MEMORABLE EXPERIENCE FOR THEM pdf
... are unable to convert each one of them Although an ability to perceive consumer differences and using them to modify your sales talk will not ensure that you will be able to convince and convert ... easily by him/her with the scope of its store and resource availability ~ By specifying a target group, a retailer will be able to carve a niche for itself and hence avoid head on competition with ... ways in which we can define a type of retail shopper, however the most common classification is based on the following aspects: On the basis of their shopping attitudes the retail customers can...
Ngày tải lên: 19/02/2014, 10:20
Tài liệu Orthodontists and patient´s aesthetic perception to different types of profi les modifi ed by a computer program pdf
... than O group For the equivalent in female profile (F4), group P granted lower scores than DDS and O groups This might suggest that group P can be more tolerant to mandibular protrusion than groups ... P groups perceive what can be considered as an attractive profile In instances of lower jaw protrusion in males, (4), group O granted higher scores than DDS and P groups This can mean that groups ... DDS group assesses as more attractive than groups O or P This suggests that DDS group considers bimaxillary retrusion as an attractive, post-treatment profile for Chinese patients, while P group...
Ngày tải lên: 19/02/2014, 17:20
Báo cáo khoa học: Binding affinities and interactions among different heat shock element types and heat shock factors in rice (Oryza sativa L.) ppt
... amplified using gene-specific primer sets (Table S2) were cloned in the pBD-GAL4 vector (Stratagene Agilent Technologies, La Jolla, CA, USA) in the EcoRI and SmaI sites All PCRs were done using PhusionÔ ... 1A) in their respective 1-kb upstream promoter region (taking A of ATG as +1) These genes were grouped on the basis of the presence of the specific HSE types, irrespective of the number of hits ... out to assess the DNA binding abilities of these OsHsfs (Fig 3) First, the EMSA was carried out using 32P-labeled model 3P-type HSE (Fig 3A) as a function of four different incubation temperatures,...
Ngày tải lên: 05/03/2014, 23:20
EVALUATION OF DIFFERENT TYPES OF CHEST SYMPTOMS FOR DIAGNOSING PULMONARY TUBERCULOSIS CASES IN COMMUNITY SURVEYS pot
... yield of pulmonary tuberculosis cases by different chest symptoms was not documented in details based on a series of community surveys It is essential to investigate the proportion of symptomatics ... yield of cases in order to suggest the symptoms that are fairly enough to employ in the community based surveys for detection of cases The data collected from three disease surveys in the community ... methods; 54-66 (60%) of the cases were identified by symptom inquiry alone whereas 82% were identified using chest radiography in both surveys In survey-III, a total of 277 cases were detected employing...
Ngày tải lên: 06/03/2014, 04:20
Báo cáo khoa học: "Chinese Term Extraction Using Different Types of Relevance" potx
... the proposed algorithms using different features for IT domain and legal domain, respectively The algorithm using CD alone is the same as the TF-IDF algorithm The algorithm using CS and CD is the ... candidate and sentences, referred to as CS, is calculated using the TV_HITS (Term Verification – HITS) algorithm proposed in (Yang et al., 2008) based on Hyperlink-Induced Topic Search (HITS) algorithm ... comparison to previous work, all term candidates are extracted from the same domain corpora using the delimiter based algorithm TCE_DI (Term Candidate Extraction – Delimiter Identification) which is...
Ngày tải lên: 08/03/2014, 01:20
Báo cáo khoa học: Drosophila proteins involved in metabolism of uracil-DNA possess different types of nuclear localization signals pdf
... but the D melanogaster dUTPase NLS belongs to the c-Myc group Interestingly, the NLS segment of human dUTPase is more similar to the first group of sequences For comparison, the classic bipartite ... NLS is a valine in c-Myc With regard to the important role of the PAAK(10–13) segment in the NLS peptide, it is noteworthy that the e-NH2 group of the lysine residue at position 13 makes numerous ... UDE ORF using a QuikChangeÒ site-directed mutagenesis kit (Stratagene, Agilent Technologies Co., La Jolla, CA, USA) according to the manufacturer’s instructions PCR reaction was performed using...
Ngày tải lên: 15/03/2014, 11:20
Báo cáo khoa học: Two different types of hepcidins from the Japanese flounder Paralichthys olivaceus ppt
... are in mammals However, at present, whether Japanese flounder hepcidins have a role in iron metabolism is not clear Using synthetic peptides, we examined the antibacterial activities of Japanese ... available in DDBJ ⁄ EMBL ⁄ GenBank using the blast program ver.2.0 (http://www ncbi.nlm.nih.gov) The arrayed genomic BAC clones of Japanese flounder [17] were screened by using the Japanese flounder hepcidin ... the results of previous report, it is speculated that hepcidins homologues may have a variety of roles in fish In this study, we cloned two different hepcidin genes and characterized their expressions...
Ngày tải lên: 30/03/2014, 20:20
Different types of hammers
... picture frames etc) to heavy duty nailers, used to fix floorboards and garden decking etc Advice for using hammers Always use the right hammer for the job, it will make the job easier and avoid possible ... expand and tighten in the head If a hammer tends to slip off nails, roughen the face of the head using a medium abrasive paper Always wear safety glasses when driving masonry nails or breaking...
Ngày tải lên: 14/04/2014, 11:28
Báo cáo sinh học: " Susceptibility of different leukocyte cell types to Vaccinia virus infection" potx
... viruses from vaccinia virus MVA strain, by inserting the GFP cassette downstream of the F13L gene, using an intergenic region for the insertion Additionally, thymidine kinase-deficient virus recombinants ... for citation purposes) Virology Journal 2004, 1:10 these viruses was again monitored in paralell using specific antibodies (Fig 2) Infection of PBLs with WR-TK(-) virus resulted in similar percentages ... (Quantum Biotechnologies, Inc.) was constructed as follows rsGFP gene in plasmid pQBI25 was amplified using oligonucleotides GFP 5' (AATATAAATGGCTAGCAAAGGAGAAGAA) and GFPH3 (TTTAAAGCTTTACTAGTGGATCCTCAG),...
Ngày tải lên: 18/06/2014, 22:20