... same cashew orchards as we did five months ago in Dong Nai, Ba Ria Vung Tau and Binh Phuoc The orchard in Ba Ria-Vung Tau was sprayed by the orchard owner, which was unexpected The data obtained ... Email: lphlan@yahoo.com Trang 32 Project Abstract Cashew is a very important crop in Vietnam, and the government has designated cashew development as a national priority Productivity of cashew ... the crematogaster ant, Crematogaster sp with large numbers occupying one third of the trees in the IPM plot, and the small black ant, Tapinoma melanocephalum, that was abundant on the remaining
Ngày tải lên: 21/06/2014, 06:20
... Vietnam Trang 42 Project Abstract Cashew is a very important crop in Vietnam, and the government has designated cashew development as a national priority Productivity of cashew has increased ... strategy (weaver ants, pruning and light-trapping) to manage the branch borer that has been one of the major concerns by all cashew growers in Vietnam He has already passed this knowledge to IAS project ... VietnamVietnamese Project Team Leader Mr La Pham Lan Australian Organisation Charles Darwin University Australian Personnel Prof Keith Christian and Dr Renkang Peng Completion date (original)
Ngày tải lên: 21/06/2014, 06:20
Project Progress Report:Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS7 " ppt
... each of which was divided into two plots: a farmer’s plot that was managed with chemical insecticides, and an IPM plot that was managed by using the weaver ants (Oecophylla smaragdina) The field ... experimental data analyses, on each monitoring occasion, two plots (farmer and IPM) were ranked, based on mean percentage damage by each major pest All the monitoring occasions in the flowering and ... or/and floral flushing terminals) and the number of freshly damaged shoots by each major pest, and percent damage was calculated The cashew yields were measured in each plot one week before harvest
Ngày tải lên: 21/06/2014, 06:20
Project Progress Report: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - Milestone 10 " pptx
... methods and skills, and their understanding of the cashew IPM program A lot of farmers said that it was the best training they had received about cashews Although weaver ants are abundant, the farmers ... master trainers did their best to pass their knowledge to the TOT trainees A final examination at the end of each TOT training was held, and all the TOT trainees successfully passed their examinations ... know natural enemies before the FFS training, but now they can recognise several important natural enemy species, such as weaver ants, ladybirds, preying mantis and wasps Trang 5Introduction Based
Ngày tải lên: 21/06/2014, 06:20
Nghiên cứu khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " ppt
... Information using weaver ants as a major component for cashew growers in Vietnam Feb 2006 – Apr 2009 (completion report) Contact Officer(s) In Australia: Team Leader Organisation Charles Darwin ... profit was achieved in the ICI plots A manual about the integrated cashew improvement (ICI) program using weaver ants as a major component has been developed for ICI program trainers and extension ... using weaver ants as a major component – photo book for cashew growers in Vietnam” has also been developed It covers • cashew variety selection, • advanced farming practice, • major diseases,
Ngày tải lên: 21/06/2014, 06:20
Collaboration for Agriculture & Rural Development: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS3 " ppt
... pvbien@hcmc.netnam.vn Trang 31 Project Abstract Cashew is a very important crop in Vietnam, and the government has designated cashew development as a national priority Productivity of cashew has been increased ... started Baseline data of the insect pest assemblage and their damage were obtained Regular monitoring and sampling of insect pests and their natural enemies in the demonstration orchards has ... monitoring all the activities, and he is also responsible for the implementation of the IPM program, for the part of the TOT training and for the field data analyses Dr Pham Van Bien and Mr La Pham Lan
Ngày tải lên: 21/06/2014, 06:20
Báo cáo nghiên cứu khoa học " INTEGRATED PEST MANAGEMENT USING WEAVER ANTS AS A MAJOR COMPONENT FOR CASHEW " doc
... has designated cashew development as a national priority The area growing cashew is about 430000 ha located in Central Highlands, South Central Coast and South East region Cashew is planted mainly ... integrated cashew improvement (ICI) program using weaver ants as a major component -Manual for ICI program trainers and extension officers in Vietnam” As planned, the manual includes up-to-date information ... examples on citrus orchards in the Mekong Delta (Vietnam) and on cashew orchards in Australia and Africa, this project was proposed with the aim of increasing cashew yield and improving nut quality
Ngày tải lên: 22/06/2014, 12:20
Teacher talk as a lexical input for incidental vocabulary acquisition of young adolescent learners in apollo english training center
... was planned)? 3 Significance of the study Recently, teacher talk as a source for incidental vocabulary learning has been of interest to many researchers However, as far as the researcher has ... Trang 1VIETNAM NATIONAL UNIVERSITY, HANOI UNIVERSITY OF LANGUAGES AND INTERNATIONAL STUDIES FACULTY OF ENGLISH LANGUAGE TEACHER EDUCATION GRADUATION PAPER TEACHER TALK AS A LEXICAL INPUT ... potential for incidental learning is relatively small After the advantage and disadvantage of the researched teacher talk are uncovered, several recommendations to maximize the good impacts and
Ngày tải lên: 16/03/2021, 09:39
Teacher talk as a lexical input for incidental vocabulary acquisition of young adolescent learners in apollo english training center
... was planned)? 3 Significance of the study Recently, teacher talk as a source for incidental vocabulary learning has been of interest to many researchers However, as far as the researcher has ... Trang 1VIETNAM NATIONAL UNIVERSITY, HANOI UNIVERSITY OF LANGUAGES AND INTERNATIONAL STUDIES FACULTY OF ENGLISH LANGUAGE TEACHER EDUCATION GRADUATION PAPER TEACHER TALK AS A LEXICAL INPUT ... potential for incidental learning is relatively small After the advantage and disadvantage of the researched teacher talk are uncovered, several recommendations to maximize the good impacts and
Ngày tải lên: 19/07/2021, 11:22
Positive photoresist as a sacrificial layer for MEMS micro component fabrication with SU 8 polymer
... steps……….37 Table 4.2 Characteristics between plastic transparency mask, soda lime glass mask and quartz mask……… 42 Table 5.1 Experimental data on the material designed and existing process used and tribological ... (CHAMPS)" - United States Patent Application US Provisional Application No.: 61/390,222 filed on October 6, 2010 2 Kia Hian Lau, Archit Giridhar, Sekar Harikrishnan, Nalam Satyanarayana and ... many areas such as biomedical Klejwa et al [16] fabricated a three axis micro strain gauge for biological application Silicon micromachining can be used to create one-axis force sensors on a
Ngày tải lên: 02/10/2015, 17:14
Novel design of a compacted micro-structured air-breathing PEM fuel cell as a power source for mobile phones
... (m&phase<0)is assumed Where m&phase is mass transfer: for evaporation (m&phase=m&evap) and for condensation (m&phase=m&cond) (kg/s) So that the mass balance equations for both phases are; ... The gas phase and the liquid phase are assumed to be in thermodynamic equilibrium, i.e., the liquid water and the gas phase are at the same temperature The potential distribution in the gas diffusion ... was used to account for the magnitude of phase change inside the GDL 2.2.3 Catalyst layers The catalyst layer is treated as a thin interface, where sink and source terms for the reactants are
Ngày tải lên: 05/09/2013, 14:58
Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry
... endo-glucanase, exo-glucanase and β-glucosidase Endo-and exo-glucanases are commonly referred to as “cellulases” Fungal strains of Trichoderma reesei are used to produce most commercial cellulase ... fractionated biomass The pretreatment has an advantage of operating at low temperature (50 °C) which capital and operating costs and minimizes degradation reactions The residual phosphoric acid ... during pretreatment [22] Degree of lignification and ash content are direct indicators of quality of biomass feedstock As wheat straw leaves contain more ash than other components and nodes are high
Ngày tải lên: 05/09/2013, 15:28
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
... Pediatr Res 2000, 48:6-11. 19 Bernasconi A, Marino R, Ribas A, Rossi J, Ciaccio M, Oleastro M, Ornani A, Paz R, Rivarola MA, Zelazko M, Belgorosky A: Characterization of immunodeficiency in a patient ... challenging, as IL-2 is first and foremost a T cell growth factor, and as such, has strong proliferative effects on all T cells, including pathogenic CD4+ and CD8+Teff cells For the past decade, IL-2 has ... Emerging Team in Clinical Autoimmunity: Immune Regulation and Biomarker Development in Pediatric and Adult Onset Autoimmune Diseases C.A.P holds a Canada Research Chair E.d ’H and M.K are recipients
Ngày tải lên: 18/06/2014, 16:20
Báo cáo y học: "Metalloproteinase and inhibitor expression profiling of resorbing cartilage reveals pro-collagenase activation as a critical step for collagenolysis" pot
... TAGGTGCATATAAACAAGAAGTA ADAMTS-1 GCTGCCCTCACACTGCGGAAC 264 CATCATGGGGCATGTTAAACAC ADAMTS-4 GCGCCCGCTTCATCACTG 101 TTGCCGGGGAAGGTCACG ADAMTS-5 AAGCTGCCGGCCGTGGAAGGAA 196 TGGGTTATTGCAGTGGCGGTAGG ADAMTS-8 ... Hydroxypro-line release was assayed as a measure of collagen degrada-tion, and glycosaminoglycan release was assayed as a measure of proteoglycan degradation [20] Collagenase and inhibitor activities ... ATAGTGATCAGGGCCAAAGCAGTC 277 TGTCCCAGGGCACGATGAAGTC TIMP-3 GATGTACCGAGGATTCACCAAGAT 356 GCCGGATGCAAGCGTAGT TIMP-4 ATATTTATACGCCTTTTGATTCCT 297 GGTACCCGTAGAGCTTCCGTTCC TCGTCCACCCCACCCTTGATG TAGGTGCATATAAACAAGAAGTA
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "Identification of Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a binding protein for a 68-kDa Bacillus thuringiensis parasporal protein cytotoxic against leukaemic cells" potx
... non-insecticidal Bt isolates resulting in a new cate-gory of Bt parasporal protein called parasporin Para-sporins are defined as bacterial parasporal proteins that are capable of preferentially killing cancer ... human leukaemic T cells Methods: Bt18 parasporal protein was separated using Mono Q anion exchange column attached to a HPLC system and antibody was raised against the purified 68-kDa parasporal ... bovine serum albumin (BSA) as standard Separation of Bt18 parasporal protein The trypsin activated parasporal protein was separated using Mono Q anion exchange column attached to a HPLC system
Ngày tải lên: 10/08/2014, 05:21
Báo cáo khoa hoc:" Evaluation of triblock copolymeric micelles of δvalerolactone and poly (ethylene glycol) as a competent vector for doxorubicin delivery against cancer" doc
... Trang 1R E S E A R C H Open Accessδ-valerolactone and poly (ethylene glycol) as a competent vector for doxorubicin delivery against cancer Lekha Nair K1, Sankar Jagadeeshan2, S Asha Nair2and ... with a mean diameter of 90 nm and high encapsulation efficiency showing a pH dependent sustained doxorubicin release Biological evaluation in breast adenocarcinoma (MCF7) and glioblastoma (U87MG) ... Poojappura, Thiruvananthapuram-695 014, Kerala, India Full list of author information is available at the end of the article © 2011 Nair et al; licensee BioMed Central Ltd This is an Open Access
Ngày tải lên: 11/08/2014, 08:20
báo cáo khoa học: " Surface electromyography as a screening method for evaluation of dysphagia and odynophagia" ppt
... Trang 1Open AccessReview Surface electromyography as a screening method for evaluation of dysphagia and odynophagia Michael Vaiman* and Ephraim Eviatar Address: Department of Otolaryngology, Assaf ... aeti-ology and localization – oral, pharyngeal, or oesophageal – of causes for dysphagia or odynophagia Each stage has its mean normal duration and its specific graphic pattern Each pair of electrodes ... normative database and standard analysis Table 2: Quick reference simplified set of normative data for electric activity obtained by surface EMG for masseter and submental group + platisma during
Ngày tải lên: 11/08/2014, 20:20
Báo cáo y học: "Lassa virus-like particles displaying all major immunological determinants as a vaccine candidate for Lassa hemorrhagic fever" ppt
... Trang 1R E S E A R C H Open AccessLassa virus-like particles displaying all major immunological determinants as a vaccine candidate for Lassa hemorrhagic fever Luis M Branco1,2, Jessica N Grove1, ... trans-mitted by aerosol, and lack of a vaccine or therapeutic drug led to its classification as a National Institutes of Allergy and Infectious Diseases (NIAID) Category A pathogen and biosafety ... coated culture surface by 48 hours, resulting in large areas of monolayer breakdown (Figure 2C) Cellu-lar cytotoxicity was measured by MTT assays, and chro-mosomal DNA fragmentation analysis was
Ngày tải lên: 12/08/2014, 01:22
Báo cáo khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " pptx
... Vietnam, and the government has designated cashew development as a national priority. The area growing cashew is about 430000 ha located in Central Highlands, South Central Coast and South East ... plot, and the small black ant, Tapinoma melanocephalum that was abundant on the remaining trees of the plot. The Crematogaster ants were nesting on cashew tree branches and the small black ant ... 2004). Based on the successful examples on citrus orchards in the Mekong Delta (Vietnam) and on cashew orchards in Australia and Africa, this project was proposed with the aim of increasing cashew...
Ngày tải lên: 21/06/2014, 05:20
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc
... followed by PCR with Taq DNA polymerase (Promega, Madison, WT, USA) using the primers 5¢-CACACTACACTGGGAAGCAGAG ACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG- 3¢. The cDNA was subcloned into ... [43–49]. Acknowledgements The authors thank Drs Masato Yasui, Sadakazu Aiso and Masaaki Matsuoka for support; Dr Andrew P. McMahon for providing the full-length mou- se Shh cDNA; Dr Neil Cashman for providing ... COS7 cells affecting the 5E1 epitope. Gup1 acts as a negative regulator for N-terminal palmitoylation of Shh Mammalian Gup1 has been described in the gene data- base cited above as a homolog of...
Ngày tải lên: 18/02/2014, 16:20
Bạn có muốn tìm thêm với từ khóa: