data a then c 0 and

... labeling options allow for comprehensive marking 100 -pair HighBand® 10 collocation block • 3 /06 200 -pair HighBand® 10 collocation block 300 -pair HighBand® 10 collocation block Ordering information ... Structured Cabling ADC’s RJ45 coupler panel provides feed-through data and voice connectivity on the front and rear for Category 5e and applications Connectivity on the front of the panel accommodates ... RJ45 coupler panel Catalog Number ADCPP24 606 ADCPP48 606 ADCPP24RJ6-S ADCPP24RJ5E-S ADCPP24 505 ADCPP48 505 ADCPP16KSRJRJ ADCPP32KSRJRJ RJ45 coupler panel (front view) 102 094AE TrueNet® Structured...

Ngày tải lên: 24/01/2014, 11:20

... predictions of broadcast signals Also, our Coronado Data Warehouse, the industry standard for broadcast signal area and VerDate 11-MAY- 200 0 07 :21 Sep 15, 200 5 Jkt 00 000 0 PO 00 000 Frm 00 045 Fmt ... Viacom/CBS Viacom/CBS Viacom/CBS Viacom/CBS Viacom/CBS Viacom/CBS Viacom/CBS Viacom/CBS 07 :21 Sep 15, 200 5 Jkt 00 000 0 PO 00 000 Frm 00 043 Fmt 6633 Sfmt 6621 207 48.TXT HCOM1 PsN: HCOM1 40 Comparing this ... Viacom/CBS Viacom/CBS Viacom/CBS Viacom/CBS Viacom/CBS Viacom/CBS Walt Disney Co./ABC Walt Disney Co./ABC Walt Disney Co./ABC Walt Disney Co./ABC Walt Disney Co./Hearst Hearst/ABC/NBC Hearst/ABC/NBC GE/NBC...

Ngày tải lên: 18/02/2014, 00:20

... pAM889 pAM8 90 pAM891 pAM892 pAM895 pAM896 pAM899 pAM 902 pAM 903 pAM 904 pAM 905 pAM 906 pAM 907 pAM 908 pAM 909 pAM9 10 pAM912 pAM913 pAM914 pAM915 pAM918 pAM919 pAM 100 1 pAM 100 2 pAM 100 3 Vector for expression ... polyclonal GFP-speci c antiserum was a gift from J Kahana and P Silver (Dana Farber Cancer Center, Boston, MA) The anti-actin mAb was MAB1 501 from Chemicon International (Temecula, CA) The anti-hexokinase ... for actin-patch formation at polarized cortical sites [29] Because cortical actin patches are short-lived structures, continual actin-patch formation at polarized cortical sites is essential for...

Ngày tải lên: 18/02/2014, 16:20

... forward, GGG GAC AAG TTT GTA CAA AAA AGC AGG CTA TCA TGC TGT TGT CAG GTC CCT CTC G; and reverse, GGG GAC CAC TTT GTA CAA GAA AGC TGG GTC AGT GGT GGT GGT GGT GGT GCA GAG GAG GGA TAT GGG GAA CGG CAA ... respectively The primers used were as follows: forward primer, GTT GGA ATT CCA TCA TCA TCA TCA TCA TCA GGG CAC GAC ACA CAT CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAG GAG GGA TAT GGG GAA ... 6 70. 931 104 5.842 1244.723 945.792 1174 .00 1 3257 .0 2.5- Hex Hex Hex 3 .0- Hex 3.5- Hex GlcNAc 4 .0- 1539.592 1375.497 1 .00 .5 600 800 100 0 1 200 1 400 1 600 1 800 200 0 2 200 2 400 2 600 2 800 300 0 3 200 m/z Fig...

Ngày tải lên: 19/02/2014, 06:20

... CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 3736 controlled ... OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT ... omcB– (lane 3), and omcA– omcB– (lane 4), and complemented strains omcA– ⁄ pBAD 202 ⁄ D-TOPOomcA (lane 5) and omcB– ⁄ pBAD 202 ⁄ D-TOPOomcB (lane 6) A molecular mass standard is indicated at the...

Ngày tải lên: 07/03/2014, 09:20

... signal peptide, was amplified by PCR to incorporate BamHI and XhoI sites at either end, using the following primers: forward, 5¢-CGCGGATCCTGGTCTTTCCAAAATATTC AGGCCA-3¢ and reverse, 5¢-GTCCTCGAGGTACATCA ... rehydrated actively for 12 h Isoelectric focusing was performed (Protean IEF Cell, Bio-Rad): 2 50 V (1 h), 500 V (for h), 100 0 V (for h, 10 000 V (gradient over h), and 10 000 V (for 90 000 Vh) at 20 C ... silver staining of plant proteins, RNA and DNA in polyacrylamide gels Electrophoresis 8, 93–99 Biswas C, Sinha D & Mandal C ( 200 0) Investigation of Achatinin, a 9-O-acetyl sialic acid-binding lectin,...

Ngày tải lên: 07/03/2014, 17:20

... II A (1-72) A 100 100 B (2-72) % ** * 100 C 6 * * 8 B % ** % 8 87 50 mass (Da) 9 200 600 mass (Da) 6 30 600 mass (Da) 6 30 Fig (A) MALDI mass spectrum of native GHP The asterisks represent an additional ... 1478. 8a 28 50. 8b ,c 2979.9b ,c 3 109 .9b ,c 9 60. 4a NS 1668. 7a 100 2. 5a 102 5. 5a 1231. 8a 1612. 8a 1944. 1a 2 402 . 3a 2289. 2a 2746. 5a NS 1321. 9a 901 . 6a 831.4b 19 90. 0a 1942. 0a 41 10. 1b 3981.1b 3852.1b 2 805 .8b ... respectively, and the peak FEBS Journal 273 ( 200 6) 2 801 –2811 ª 200 6 The Authors Journal compilation ª 200 6 FEBS 2 803 GHP, a new cytochrome c from H salexigens G Van Driessche et al Table Mass and sequence...

Ngày tải lên: 08/03/2014, 08:20

... Investigaciones Cientı´ ficas y ´ ´ Tecnicas (CONICET), Secretarı´ a de Ciencia y Tecnica de la Univer´ ´ sidad Nacional de Cordoba y Agencia Cordoba Ciencia del Gobierno ´ de la Provincia de Cordoba, ... y Tecnologica de la Secretarı´ a de Ciencia y Tecnologı´ a del Ministerio de Cultura y ´ ´ ´ Educacion en el marco del Programa de Modernizacion Tecnologica (BID 802 /OC-AR), Consejo Nacional de ... were inactivated by addition of mL 5% trichloroacetic acid and heated at 90 C for 15 Radioactivity bound to protein was measured in hot-trichloroacetic acid-insoluble material as described previously...

Ngày tải lên: 17/03/2014, 10:20

Ngày tải lên: 17/03/2014, 13:38

Ngày tải lên: 17/03/2014, 13:38

... GdnHCl and urea when electronic interactions play a role in their stability Conformational changes at low chemical denaturant concentrations – structural and functional implications The elucidation ... intermediate accumulated between 0. 5 and m GdnHCl The intrinsic Trp fluorescence and extrinsic ANS fluorescence data indicated that GdnHCl-induced PARN unfolding involved at least two intermediates accumulated ... domain of poly (A) -speci c ribonuclease has a noncanonical binding site for mRNA cap analog recognition Nucleic Acids Res 36, 4754– 4767 Monecke T, Schell S, Dickmanns A & Ficner R ( 200 8) Crystal...

Ngày tải lên: 23/03/2014, 04:21

... approximately 263 nm and a negative band at approximately 2 40 nm, whereas antiparallel G4 structures, such as basket and chair forms, show two positive bands at approximately 295 and 2 40 nm and ... maintained at D2 20 3 30 in the range 0. 2 0. 8, and the CD data represent three averaged scans taken at an experimental temperature (25– 90 C) All CD spectra are baselinecorrected for signal contributions ... grants from the Slovak Grant Agency (1 ⁄ 1274 ⁄ 04 and ⁄ 3254 ⁄ 06 ) and the Science and Technology Assistance Agency (APVT 20- 006 604 ) I would like to thank Gavin Cowper and Lenka Sieber for critically...

Ngày tải lên: 23/03/2014, 06:20

... in standard aminoacylation reactions Km and kcat values with respect to both tRNA and serine (Km ¼ 51 ± lm and kcat ¼ 0. 47 ± 0. 02 s)1 for serine; Km ¼ 0. 65 ± 0. 07 lm and kcat ¼ 0. 54 ± 0. 02 s)1 ... temperature, and checked periodically for the appearance of a blue color that developed between 30 and h b-Galactosidase activity was quantified using Gal-ONp as a substrate in assays carried out according ... synthesis quality control in Archaea Proc Natl Acad Sci USA 101 , 102 60 102 65 29 Dagkessamanskaia A, Martin-Yken H, Basmaji F, Briza P & Francois J ( 200 1) Interaction of Knr4 protein, a protein...

Ngày tải lên: 23/03/2014, 09:20

... bi-glycosylated and the 18 00 0-Da band as monoglycosylated (Fig 2) The deglycosylated 14 400 -Da band may correspond to the truncation of about 20 amino acids in the embryonic IFN -c molecule, as ... that the structural and chemical characteristics of TrIFN -c affects its bioavailability and biological effect(s) on the maternal uterus In particular, this shortened version of IFN -c, lacking a ... mgÆmL)1 of a- cyano-4-hydroxycinnamic acid matrix in 50% (v/v) acetonitrile and 0. 1% (v/v) trifluororacetic acid For acquisition, the accelerating voltage used was 20 kV Peptide spectra were recorded...

Ngày tải lên: 24/03/2014, 04:21

... were analyzed after dephosphorylation for (lanes and 7), (lanes and 8), 10 (lanes and 9), and 20 (lanes and 10) antibody against Cdc37 and the only band that became radioactive after incubation ... Journal 274 ( 200 7) 56 90 5 703 ª 200 7 The Authors Journal compilation ª 200 7 FEBS Y Miyata and E Nishida Cdc37 phosphorylation by CK2 and signaling kinases A B C D E F Fig Subcellular localization ... [19,21], which constitutes a consensus Fig Phospho-speci c antibody against an Hsp 90 cochaperone, Cdc37 (A, B) Recombinant Cdc37 was incubated at 30 C for 30 alone (lanes 1–3), with CK 2a (lanes 4–6),...

Ngày tải lên: 30/03/2014, 03:20

... http://www.nov agen.com/SharedImages/TechnicalLiterature/7_tb055.pdf Datta, A. B., Chakrabarti, P., Subramanya, H.S & Parrack, P ( 200 1) Purification and crystallization of CII: an unstable transcription activator ... Oppenheim, A. B ( 200 2) The phage CII transcriptional activator carries a C- terminal domain signaling for rapid proteolysis Proc Natl Acad Sci USA 99, 14964–14969 Novagen ( 200 2) pET System Manual, 10th ... mM EDTA and 100 mM NaCl (buffer E) Circular dichroism and fluorescence experiments Far-UV CD and fluorescence data were recorded using lM protein in buffer E containing GdnHCl or other salts to...

Ngày tải lên: 30/03/2014, 20:20

... the data type Thus in: typedef int Array[ 10] ; Array becomes a data type for an array of 10 integers i.e Array my_arr; declares my_arr as an array of 10 integers and Array arr2d[5]; makes arr2d an ... the char and s appending the [ 10] we have an array of 10 characters But, the name multi[5] is itself an array indicating that there are elements each being an array of 10 characters Hence we have ... array of characters, with the last character being a ' \0' What we have done above is deal with copying an array It happens to be an array of characters but the technique could be applied to an array...

Ngày tải lên: 05/04/2014, 01:21

... Sandra Data structures in Java: a laboratory course / Sandra Andersen p cm ISBN 0- 7637-1816-5 Java (Computer program language) Data structures (Computer science) I Title QA76.73.J38 A4 6 200 1 00 5.13’3—dc21 ... algorithm and data structure for a particular set of resource constraints takes practice An emphasis on learning by doing is used throughout Data Structures in Java: A Laboratory Course In each laboratory, ... GregorianCalendar class method isLeapYear( ) This is possible because the Logbook class contains a data member from the GregorianCalendar class If there were no GregorianCalendar (logCalendar) data...

Ngày tải lên: 17/04/2014, 09:15

... 10 characters Add a TextBox and call it t2 Change its text to 1- 10 Add a Label and change its text to 10 characters Add a TextBox and call it t3 Change its text to 1- 10 Add a CheckBox called chkSelect ... txtAlpha.CharacterCasing = CharacterCasing.Lower txtMixed.CharacterCasing = CharacterCasing.Upper AddHandler txtAlpha.KeyPress, AddressOf Me.InputValidator AddHandler txtNumber.KeyPress, AddressOf ... cmbMaxLen Add a Label and change its text to Upper Case Add a TextBox and call it txtUpper Add a Label and change its text to Password Add a TextBox and call it txtPassword Add a Label and change...

Ngày tải lên: 17/04/2014, 09:16