creating numbers between 1 and a user defined maximum

Báo cáo y học: " Journey to the heart of macrophages: the delicate relationship between HIV-1 and a multifaceted cell type" ppt

Báo cáo y học: " Journey to the heart of macrophages: the delicate relationship between HIV-1 and a multifaceted cell type" ppt

... encephalitis (HIVE) is described by the accompanying review of Gras and Kaul [11 ] Finally, the interplay between macrophage polarization and the effect that different viral proteins exert on the activation ... the heart of macrophages: the delicate relationship between HIV -1 and a multifaceted cell type Retrovirology 2 010 7:28 Submit your next manuscript to BioMed Central and take full advantage of: ... Retrovirology 2 010 , 7:34 13 Herbein G, Varin A: The macrophage in HIV -1 infection: from activation to deactivation? Retrovirology 2 010 , 7:33 doi :10 .11 86 /17 42-4690-7-28 Cite this article as: Cimarelli:...

Ngày tải lên: 12/08/2014, 23:23

2 291 0
Báo cáo khoa học: Interactions between metals and a-synuclein ) function or artefact? pptx

Báo cáo khoa học: Interactions between metals and a-synuclein ) function or artefact? pptx

... treatment for Parkinson’s disease and related disorders FASEB J 18 , 13 15 13 17 Fujiwara H, Hasegawa M, Dohmae N, Kawashima A, Masliah E, Goldberg MS, Shen J, Takio K & Iwatsubo T (2002) Alpha-synuclein ... V, Douay X, Lincoln S, Levecque C, Larvor L, Andrieux J, Hulihan M et al (2004) Alpha-synuclein locus duplication as a cause of familial Parkinson’s disease Lancet 364, 11 67 11 69 18 Masliah E, ... to cause disease These mutations are associate with early onset of the disease and has the pathology includes LBs and is autosomal dominant [ 21] a- synuclein a- synuclein is a small (14 kDa), highly...

Ngày tải lên: 07/03/2014, 10:20

9 470 0
Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot

Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot

... CAF -1 and acetylated histones H3/H4 Cell 87, 95 10 4 Kaya H, Shibahara KI, Taoka KI, Iwabuchi M, Stillman B & Araki T (20 01) FASCIATA genes for chromatin assembly factor -1 in Arabidopsis maintain ... J Biochem 269, 16 4 17 4 45 Nara T, Hamada F, Namekawa S & Sakaguchi K (20 01) Strand exchange reaction in vitro and DNAdependent ATPase activity of recombinant LIM15/ DMC1 and RAD 51 proteins from ... 5¢-CGGGATCCA TGTCGGGAGCAGATTCA; 381R, 5¢-TGCTACTTCTC TCAGCGGCCGCATTCTTAT CcCac1L-C: 382F, 5¢-CA TGCCATGGTGTCAGGGGATGTAGAAATG; 812 R, 5¢-GAGATTTCAGTTTCGTCACTCGAGCGG To overexpress N-terminal hexahistidine-tagged...

Ngày tải lên: 07/03/2014, 05:20

10 488 0
Báo cáo khoa học: "THE SYNTAX AND SEMANTICS OF USER-DEFINED MODIFIERS IN A TRANSPORTABLE NATURAL LANGUAGE PROCESSOR" pot

Báo cáo khoa học: "THE SYNTAX AND SEMANTICS OF USER-DEFINED MODIFIERS IN A TRANSPORTABLE NATURAL LANGUAGE PROCESSOR" pot

... to appear 24 Ginsparg, J A robust portable natural language data b a s e i n t e r f a c e Cmlf on Ap '1) lied Nc~t~ral L~znguage Processing, S a n t a Munica, Ca., 19 83, pp 25-30 Biermann, A and ... Cambridge, Mass., 19 72 23 Woods, W., Kaplan, R and Nash-Webber, Ballard, B and Tinkham, N A phrase-structured grammatical formalism for transportable natural language processing, llm~r J Cow~p~t~zt~na~ ... /~-mah~ ~ystoma, (19 84), 1, pp 1- 25 21 Waltz, D An English language question answering system for a large relational database Cowzm A C M 21 (19 78), 7, pp 526-539 22 Woods, W Semantics and quantification...

Ngày tải lên: 17/03/2014, 19:21

5 453 0
NONLINEARITIES BETWEEN ATTITUDE AND SUBJECTIVE NORMS IN INFORMATION TECHNOLOGY ACCEPTANCE: A NEGATIVE SYNERGY?1

NONLINEARITIES BETWEEN ATTITUDE AND SUBJECTIVE NORMS IN INFORMATION TECHNOLOGY ACCEPTANCE: A NEGATIVE SYNERGY?1

... Variances of the nonlinear indicators (interaction) such as x1z1 will be given by Var(x1z1) = λx1²λz1²[Var(X)Var(Z) + Cov2(X,Z)] + λx1²Var(X)Var(εz1) + λz1²Var(Z)Var(εx1) (7) + Var(εz1)Var(εx1) ... Hall Albarracín, D T., Johnson, B T., and Zanna, M P 2005 The Handbook of Attitudes, Mahwah, NJ: Lawrence Erlbaum Associates Publishers Andrews, K H., and Kandel, D B 19 79 “Attitude and Behavior: ... and Wan 19 96; Kenny and Judd 19 84; Ping 19 96): • Variances of the nonlinear indicators (quadratic) will be given by Var(x1x1) = 2λx1²λx1²Var2(X) + 4λx12Var(X)Var(εx1) (10 ) + 2Var(εx1)2 • Loadings...

Ngày tải lên: 08/04/2014, 18:33

19 361 0
Báo cáo y học: "HTLV-1 in rural Guinea-Bissau: prevalence, incidence and a continued association with HIV between 1990 and 2007" doc

Báo cáo y học: "HTLV-1 in rural Guinea-Bissau: prevalence, incidence and a continued association with HIV between 1990 and 2007" doc

... Science Park, Singapore) as described [15 ,25] mo 16 6 HTLV -1 TAX IR CTTRACAAACATGGGGAGGAAAT mo 013 B2M OF TAGAGGTTCCCAGGCCACTA mo 014 B2M OR ACCATGTAGCCTATGCGTGT mo 015 B2M IF ACAAGGAGCTCCAGAAGCAA mo ... HIV-negative persons) Statistical methods Data were double entered in an Access (Microsoft, Redmond, WA, USA) database and validated The analysis was performed using Stata 11 (Stata Corporation, ... HTLV -1 p24 OF TCCCTCCTAGCCAGCCTAC mo 077 HTLV -1 p24 IF CATCCAAACCCAAGCCCAGA mo 078 HTLV -1 p24 IR CTCCAGTGGCCTGCTTTCC mo 079 HTLV -1 p24 OR TCTCGCTTCCAGTGAGTTGG mo 16 3 HTLV -1 TAX OF CGGATACCCAGTCTACGTGTTT...

Ngày tải lên: 13/08/2014, 01:20

9 340 0
Báo cáo y học: " A balanced transcription between telomerase and the telomeric DNA-binding proteins TRF1, TRF2 and Pot1 in resting, activated, HTLV-1-transformed and Tax-expressing human T lymphocytes" pot

Báo cáo y học: " A balanced transcription between telomerase and the telomeric DNA-binding proteins TRF1, TRF2 and Pot1 in resting, activated, HTLV-1-transformed and Tax-expressing human T lymphocytes" pot

... 5'-TGTTTGGAGACTGTGTACAAGGCG-3', hTERT sense, 5'-TGTTTCTGGATTTGCAGGTG-3' and antisense, 5'-GTTCTTGGCTTTCAGGATGG-3', Pot1 sense, 5'TGGGTATTGTACCCCTCCAA-3' and antisense, 5'-GATGAAGCATTCCAACCACGG-3' TRF1 ... Ikeda S, Yamasaki Y, Hata T, Yamada Y, Tanaka Y, Tomonaga M, Yamamoto N: Constitutive activation of transcription factor AP -1 in primary adult T-cell leukemia cells Blood 2000, 95:3 915 -39 21 Chung ... TRF1 sense,5'-GCTGTTTGTATGGAAAATGGC-3' and antisense: 5'CCGCTGCCTTCATTAGAAAG-3', TRF2 sense, 5'-GACCTTCCAGCAGAAGATGC-3' and antisense, 5'-GTTGGAGGATTCCGTAGCTG-3' The thermal cycling conditions...

Ngày tải lên: 13/08/2014, 09:21

10 285 0
Báo cáo y học: " Evolution of the HIV-1 envelope glycoproteins with a disulfide bond between gp120 and gp41" pdf

Báo cáo y học: " Evolution of the HIV-1 envelope glycoproteins with a disulfide bond between gp120 and gp41" pdf

... http://www.retrovirology.com/content /1/ 1/3 wt SOS SOS-X A5 01 A5 01C A5 01C T605 T605C T605C Q5 91 Q5 91 Q5 91 A5 01C 11 /11 A5 01C A5 01C A5 01C C605Y C605Y C605Y C605Y Q591L Q591L L591Q Q593L Q593L 2 /11 1/ 11 Q5 91 1 /1 L593 L593 1/ 11 L593Q ... Virus spread CA-p24 (pg/ml) A5 01C T605C A5 01C T605C (SOS) 10 1 10 0 10 7 10 6 wt A5 01C T605C SOS 10 5 10 4 10 3 10 2 days post infection 10 D 10 6 A5 01C T605C gp 41 T605C 10 5 10 4 10 3 A5 01C T605C gp120 10 2 T605C ... SupT1 SupT1 SupT1 SupT1 MT-2 MT-2 MT-2 MT-2 MT-2 MT-2 10 10 10 10 10 10 10 40 40 40 10 10 10 40 40 40 0 .1 0.3 0 .1 0.3 0 .1 0.3 0 .1 0.3 + a after weeks (12 weeks for cultures A- D) 10 10 6 CA-p24 (pg/ml)...

Ngày tải lên: 13/08/2014, 13:20

11 394 0
 Báo cáo y học: "Discriminating between elderly and young using a fractal dimension analysis of centre of pressure"

Báo cáo y học: "Discriminating between elderly and young using a fractal dimension analysis of centre of pressure"

... However, with recent advances in the area of chaos and mathematics, in particular non-linear techniques for analysis, fractal patterns of natural phenomena are being revealed A fractal pattern gives ... is a paradigm shift towards recognising the chaotic properties of natural phenomena and the use of appropriate non-linear analysis, such as fractal analysis, in place of traditional analyses [1] ... original data can be considered appropriate Recently Parkinsonian patients (PP), spinocerebellar ataxia (SCA) patients, and healthy participants’ COP were analysed using a more traditional fractal dimension...

Ngày tải lên: 03/11/2012, 10:09

10 460 0
A comparative study of criticism between american and vietnamese online newspapers

A comparative study of criticism between american and vietnamese online newspapers

... readers 15 4 .1 4 .1. 1 Chapter 4: RESEARCH AND DATA ANALYSIS Methodology Research questions This research aims at answering the following questions: - What are the ways that American and Vietnamese ... criticism between American and Vietnamese online newspapers through the layout and illustrations of articles as well as the language used 4.2 4.2 .1 Data analysis and findings Structure of the articles ... discrimination via the picture of their new president Barack Obama and the confirmation that “we’ve moved beyond race” Also, graphs and maps are used to clarify data presented in a critical story and...

Ngày tải lên: 07/11/2012, 14:44

37 767 6
RELATIONSHIP BETWEEN ALLOCHTHONOUS DOC CONCENTRATION AND A SPECIFIC UV254 ABSORBANCE (SUVA) AT A MESO-STRATIFIED RESERVOIR

RELATIONSHIP BETWEEN ALLOCHTHONOUS DOC CONCENTRATION AND A SPECIFIC UV254 ABSORBANCE (SUVA) AT A MESO-STRATIFIED RESERVOIR

... Reservoir area Watershed area Reservoir length Average depth Water capacity Effective capacity Yearly average inflow, outflow Hydraulic residence time Urban area in drainage basin Paddy area in drainage ... organic carbon loading exactly as having great spatial variance depending on local conditions such as watershed characteristics and algal species and population Autochthonous organic matter by algae ... season Dry season All data Upper layer Wet season Dry season Middle layer Wet season Dry season Bottom layer Wet season Dry season All data at Jannge site Wet season Dry season All data at Jannge site...

Ngày tải lên: 05/09/2013, 08:40

7 433 0
Create and Call SQL Server 2000 User-Defined

Create and Call SQL Server 2000 User-Defined

... Create the UDF Code, and Assign It to a Label for Display and Use Later Private Sub frmHowTo6_8_Load(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles MyBase.Load ' Create ... @ProdAndCatTab TABLE ( ProductID int, ProductName nvarchar(80), CategoryName nvarchar(80), UnitPrice int ) By including the opening and closing parentheses, you can specify and return an entire table's ... which is actually a single value of one of the standard data types, or pass back a new Table data type The example for this How-To creates and returns a Table data type, specified with the following...

Ngày tải lên: 28/10/2013, 19:15

8 418 0
Tài liệu Navigating Between Parent and Child Records Using a DataRelation pptx

Tài liệu Navigating Between Parent and Child Records Using a DataRelation pptx

... ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable orderTable = new DataTable(ORDERS_TABLE); da.Fill(orderTable); ds.Tables.Add(orderTable); // Fill the OrderDetails table and add it to the DataSet da = new SqlDataAdapter("SELECT ... // DataSet ds = new DataSet( ); SqlDataAdapter da; // Fill the Order table and add it to the DataSet da = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["Sql_ConnectString"]); ... can have multiple parents This method returns an array of DataRow objects Few commercial database products support manyto-many relationships between parent and child records Many-to-many relationships...

Ngày tải lên: 14/12/2013, 18:16

3 344 0
Tài liệu Creating User-Defined Functions pdf

Tài liệu Creating User-Defined Functions pdf

... Unlike a scalar function, you don't have to add the owner when calling an inline tablevalued function You use a SELECT statement to read the table returned by the function as you would any other table ... FUNCTION statement, and you can modify a function using the ALTER FUNCTION statement Once you've created the function, you can call it When calling a scalar function, you use the following syntax: owner.functionName ... ProductID = 1; Using Inline Table-Valued Functions An inline table-valued function returns an object of the table type, which is populated using a single SELECT statement Unlike a scalar function, an...

Ngày tải lên: 26/01/2014, 07:20

7 275 0
Tài liệu User Defined Primitives part 1 pdf

Tài liệu User Defined Primitives part 1 pdf

... best way to explain a state table is to take the example of an and gate modeled as a UDP Instead of using the and gate provided by Verilog, let us define our own and gate primitive and call it ... in Example 12 -4 is identical to Example 5-7 on page 75 except that the standard Verilog primitives and and or primitives are replaced with udp _and and upd_or primitives Example 12 -4 Instantiation ... udp _and Example 12 -1 Primitive udp _and //Primitive name and terminal list primitive udp _and( out, a, b); //Declarations output out; //must not be declared as reg for combinational UDP input a, ...

Ngày tải lên: 26/01/2014, 14:20

9 304 1
w