creating a map with multiple layers

báo cáo khoa học: "Bilateral adrenocortical carcinoma in a patient with multiple endocrine neoplasia type 1 (MEN1) and a novel mutation in the MEN1 gene" potx

báo cáo khoa học: "Bilateral adrenocortical carcinoma in a patient with multiple endocrine neoplasia type 1 (MEN1) and a novel mutation in the MEN1 gene" potx

... Novotny EA, Garrett-Beal L, Ward JM, Libutti SK, Richard Alexander H, Cerrato A, Parisi MJ, Santa Anna-AS, Oliver B, Chandrasekharappa SC, Collins FS, Spiegel AM, Marx SJ: Molecular pathology ... 89:143-150 11 Carrasco CA, González AA, Carvajal CA, Campusano C, Oestreicher E, Arteaga E, Wohllk N, Fardella CE: Novel intronic mutation of MEN1 gene causing familial isolated primary hyperparathyroidism ... A, Gallart L, Martín-Campos JM, Catasús L, Mayoral C, Mato E, Tortosa F, Bernà L, Rodríguez-Espinosa J, Blanco-Vaca F, Matías-Guiu X, de Leiva A, Mauricio D: Genetic, clinical, and biochemical...

Ngày tải lên: 09/08/2014, 01:24

7 413 0
báo cáo khoa học: "Lenalidomide induced good clinical response in a patient with multiple relapsed and refractory Hodgkin''''s lymphoma" pptx

báo cáo khoa học: "Lenalidomide induced good clinical response in a patient with multiple relapsed and refractory Hodgkin''''s lymphoma" pptx

... Lactate dehydrogenase (U/L) < 241 250 175 Aspartate aminotransferase (U/L) 8-30 20 16 Alanine aminotransferase (U/L) 10-36 16 Gamma-glutamyl transpeptidase (U/L) 9-35 15 10 Alkaline phosphatase ... physical condition and although her laboratory results showed mild leucopenia (World Health Organization hematologic toxicity scale grade 2), no dose reduction was required (Table 1) However, a third ... relapsed or refractory classical Hodgkin lymphoma [abstract] [http://ash.confex.com/ash/2009/webprogram/ Paper18377.html] Böll B, Borchmann P, Topp MS, Hänel M, Reiners KS, Engert A, Naumann...

Ngày tải lên: 10/08/2014, 22:21

3 286 0
báo cáo khoa học: "Oculomotor nerve palsy associated with bortezomib in a patient with multiple myeloma: a case report" pps

báo cáo khoa học: "Oculomotor nerve palsy associated with bortezomib in a patient with multiple myeloma: a case report" pps

... 30353, AlKhobar, 31952, Saudi Arabia 2Radiology Department, Saad Specialist Hospital, Prince Faisal Bin Fahed Street, P.O Box 30353, AlKhobar, 31952, Saudi Arabia Authors’ contributions HE analyzed ... antagonists and neuropathy Journal of Muscle Nerve 2008, 37(3):281-292 Ravaglia S, Corso A, Piccolo G, Lozza A, Alfonsi E, Mangiacavalli S, Varettoni M, Zappasodi P, Moglia A, Lazzarino M, Costa A: Immune- ... immunomodulating agents, such as cyclosporin, tumor necrosis factor alpha antagonists (infliximab, etanercept, adalimumab), or to that of autologous peripheral blood stem cell transplantation, which have...

Ngày tải lên: 11/08/2014, 02:21

4 270 0
Báo cáo y học: " Concomitant homozygosity for the prothrombin gene variant with mild deficiency of antithrombin III in a patient with multiple hepatic infarctions: a case report" pdf

Báo cáo y học: " Concomitant homozygosity for the prothrombin gene variant with mild deficiency of antithrombin III in a patient with multiple hepatic infarctions: a case report" pdf

... lethargy with reduced appetite A unilateral leg oedema was noticed A gastroscopy was normal and a computed tomography (CT) scan confirmed splenomegaly (13.5 cm), though he had a normal liver and ... Epstein-Barr virus, hepatitis A virus and hepatitis C virus was negative An autoimmune screen was negative (rheumatoid arthritis, antinuclear antibody, anti-mitochondrial antibody, anti-liver ...

Ngày tải lên: 11/08/2014, 12:20

3 359 0
Báo cáo y học: "Fast-growing pancreatic neuroendocrine carcinoma in a patient with multiple endocrine neoplasia type 1: a case report" pptx

Báo cáo y học: "Fast-growing pancreatic neuroendocrine carcinoma in a patient with multiple endocrine neoplasia type 1: a case report" pptx

... Situs at laparotomy before and after resection (A) Intra-operative ultrasound at laparotomy (B) Situs at laparotomy (asterisk indicates the tumor; S, stomach; P, pylorus; PH, pancreatic head; D, ... a tumor in the pancreatic tail with a diameter of 25 mm without any radiological signs of malignancy Endoscopic ultrasound (EUS) visualized two small lesions in the pancreatic tail (Figure 1A) ... imaging procedures This patient was scheduled for a laparoscopic distal pancreatic resection after laparoscopic ultrasound (LUS) to rule out additional tumors in the pancreatic head and body At...

Ngày tải lên: 11/08/2014, 19:21

7 239 0
Báo cáo y học: "Resolution of cast nephropathy following free light chain removal by haemodialysis in a patient with multiple myeloma: a case report" ppsx

Báo cáo y học: "Resolution of cast nephropathy following free light chain removal by haemodialysis in a patient with multiple myeloma: a case report" ppsx

... FLC concentrations fall, intratubular casts can resolve within weeks Early diagnosis and treatment may facilitate reversal of acute renal failure This observation has important implications for ... manuscript CH, NA, MC and HO had significant roles in data gathering, analysis, interpretation and performing critical revisions to the manuscript AB and PC had a significant role in data gathering, ... was moderate diffuse interstitial fibrosis and tubular atrophy A diagnosis of multiple myeloma and acute renal failure due to cast nephropathy was made For the first weeks, the patient was managed...

Ngày tải lên: 11/08/2014, 19:21

5 301 0
Báo cáo y học: " Morphologically and immunohistochemically undifferentiated gastric neoplasia in a patient with multiple metastatic malignant melanomas: a case report" pot

Báo cáo y học: " Morphologically and immunohistochemically undifferentiated gastric neoplasia in a patient with multiple metastatic malignant melanomas: a case report" pot

... melanoma is 7.5 months with a 5-year survival rate of 6% Patients with GIT metastases have a median survival time of 12.5 months with a 5-year survival rate of 14% Survival is strictly related ... with multiple metastatic melanoma, who presented to our unit with vomiting and was later diagnosed with a gastric neoplasia with no histological and immunohistochemical characteristics referable ... appearance of multiple masses localized on the left arm, both axillae and at the level of the primary melanoma surgical scar The patient underwent a total-body bone scintigraphy that showed an...

Ngày tải lên: 11/08/2014, 23:21

5 269 0
Lab 4.1.4 Creating a Network Map using CDP

Lab 4.1.4 Creating a Network Map using CDP

... for a password, enter class If “class” does not work, ask the instructor for assistance Router>enable At the privileged EXEC mode, enter the command erase startup-config Router#erase startup-config ... type of router as well as how many interfaces the router has There is no way to effectively list all of the combinations of configurations for each router class What is provided are the identifiers ... ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface 4-4 CCNA 2: Routers and Routing Basics v 3.0 - Lab 4.1.4 Copyright...

Ngày tải lên: 04/11/2013, 16:15

4 505 0
Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc

Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc

... 1078–1085 Sharma K, Chandra H, Gupta PK, Pathak M, Narayan A, Meena LS, D’Souza RC, Chopra P, Ramachandran S & Singh Y (2004) PknH, a transmembrane Hank’s type serine ⁄ threonine kinase from Mycobacterium ... suggested as one of the targets for a signal transduction pathway mediated by PknA and PknB If so, this pathway could link cell division and peptidoglycan synthesis with arabinogalactan synthesis, another ... were resolved by SDS ⁄ PAGE and the loss of labeling was visualized by autoradiography ATPase activity measurements The malachite green ATPase assay The reaction buffer contained 10 lL of 10· TMD...

Ngày tải lên: 16/03/2014, 14:20

11 402 0
CREATING A SUPPORTIVE ENVIRONMENT FOR ELDERLY WITH CHRONIC ILLNESS potx

CREATING A SUPPORTIVE ENVIRONMENT FOR ELDERLY WITH CHRONIC ILLNESS potx

... demand a multidisciplinary collaborative approach among different professionals and organizations in the community Overseas experiences have shown that community-based, and coordinated medical and ... reflected that the linkage between hospitals and social welfare agencies was inadequate (Department of Social Work and Social Administration, HKU, 1998) Indeed, the varying needs of elderly with chronic ... coordination and quality of community-based care This can be done by fostering a holistic and continuous approach, and strengthening social support through the collaboration of formal and informal...

Ngày tải lên: 22/03/2014, 14:20

7 507 0
Báo cáo khoa học: CmtR, a cadmium-sensing ArsR–SmtB repressor, cooperatively interacts with multiple operator sites to autorepress its transcription in Mycobacterium tuberculosis pptx

Báo cáo khoa học: CmtR, a cadmium-sensing ArsR–SmtB repressor, cooperatively interacts with multiple operator sites to autorepress its transcription in Mycobacterium tuberculosis pptx

... CAGCTAGCTGGCCGGGATAGC P1F P1R GCCGATCATATCTGCTATGG CCATAGCAGATATGATCGGC P2F P2R ATGTACAATTCAGCTCTTGCT AGCAAGAGCTGAATTGTACAT P3F P3R GCTGTTATACCAGTATATGG CCATAT ACTGGTATAACAGC P4F P4R TGGTGTACTAATTTGATCTATG ... GTCCTGTAAGCTTAAGTCGTGTC P3 P4 P6 TTCCCGCATCTCACACGTCA CATATCTGCTATGGATGTAC GTCACACCTTTCGTCGCAGC P8 94RTf 94RTr 1994intR TGTTATACCAGTATATGGTGTACTA CTCGGCCTCAACTACAGTCGT ACAGGTAGCTGAGCAGCAGAC CAGCTAGCTGGCCGGGATAGC ... TGGTGTACTAATTTGATCTATG CATAGATCAAATAGTACACCA H1 CGAGTCGACCGGAGGACCTTT GGCCCTGCGTCGACCGA TCGGTCGACGCAGGGCCAAAG GTCCTCCGGTCGACTCG H2 Experiment CmtR protein expression CmtR protein expression Reporter assay EMSA Reporter...

Ngày tải lên: 23/03/2014, 04:21

12 463 0
Creating a glass object with max and vray

Creating a glass object with max and vray

... cheked and on V-ray shadows parameters check Transparent shadows and area shadow Use a plane for the scene and assign a white color to this It looks fine, but not really :) The glass need something ... reflect To this use a HDRI map You can find some HDRI images at this address http://athens.ict.usc.edu/Probes/ and assign this to V-ray Environment and the result And with caustics the scene will ... Image Sampler(Antialising), turn of the Adaptive subdivision For the glass materials use this settings: and for the liquid this For the lighting I have used an Omni light, V-ray shadows cheked and...

Ngày tải lên: 01/04/2014, 17:32

15 280 0
picture yourself building a website with joomla! 1.6[electronic resource] step-by-step instruction for creating a high-quality, professional-looking site with ease

picture yourself building a website with joomla! 1.6[electronic resource] step-by-step instruction for creating a high-quality, professional-looking site with ease

... use it After you create a database, you must associate a user with a username and password with the database Joomla! asks you for that information during the installation process so, again, write ... Installing Joomla! 1.6 requires a series of steps on a Webserver Ǡ A MySQL database with a username, password, and database name is required Ǡ The database is created via the Website control panel ... the Category Manager opens a manager that includes Articles, Categories, and Featured Articles tabs The page opens automatically to the Categories tab Figure 2-4 shows the Category Manager: Articles...

Ngày tải lên: 29/05/2014, 23:54

320 860 0
báo cáo hóa học: " Effect of pioglitazone treatment in a patient with secondary multiple sclerosis" doc

báo cáo hóa học: " Effect of pioglitazone treatment in a patient with secondary multiple sclerosis" doc

... 1994, a trial of interferon β-1b was discontinued because of increased spasticity, and she was not a candidate for glatiramer She had no history of diabetes, cardiovascular, liver or kidney disease ... final draft of the manuscript Acknowledgements We thank Monica Menendez for secretarial assistance Supported by grants from the National Multiple Sclerosis Society (DLF), Takeda Pharmaceuticals ... throughout an additional 18 months Weight gain was evident as increased muscle mass and peripheral fat, mainly in the hips, gluteal area, and limbs Upper extremity strength and coordination progressively...

Ngày tải lên: 19/06/2014, 22:20

4 322 0
báo cáo hóa học: " Soluble HLA measurement in saliva and cerebrospinal fluid in Caucasian patients with multiple sclerosis: a preliminary study" pdf

báo cáo hóa học: " Soluble HLA measurement in saliva and cerebrospinal fluid in Caucasian patients with multiple sclerosis: a preliminary study" pdf

... Racial-ethnic factors may also have an influence on sHLA levels [18,19] Thus, it appears advantageous to assess sHLA measurements in subjects with a similar racial-ethnic background Theoretically, ... sHLA-I or L 2.03 Mab for sHLA-II were added to each bead and incubated for an additional hour at 45°C After additional washes, the color reaction was started by adding the appropriate substrate ... reviewed with the patient and signed Brain MRI was performed using a 1.5 T machine with a standard quadrature head coil The imaging protocol included sagittal T1-, axial T1-, T2-weighted, and fluid attenuated...

Ngày tải lên: 19/06/2014, 22:20

7 326 0
Báo cáo hóa học: " Research Article A Low-Complexity LMMSE Channel Estimation Method for OFDM-Based Cooperative Diversity Systems with Multiple Amplify-and-Forward Relays" docx

Báo cáo hóa học: " Research Article A Low-Complexity LMMSE Channel Estimation Method for OFDM-Based Cooperative Diversity Systems with Multiple Amplify-and-Forward Relays" docx

... single-relay-assisted cooperative communication scenario Training designs that are optimal in the scenarios of multiple- relays-assisted cooperative communication have drawn relatively little attention ... K × K linear transformation unitary matrix to ensure channel identifiable, as explained later; αi is the relay amplification factor to meet the power constraint for each relay terminal and is given ... channel statistics α and the noise power γ are not available at the destination terminal, we can resort to the LS channel estimator to obtain initial channel estimates and then use these estimates...

Ngày tải lên: 22/06/2014, 00:20

9 293 0
báo cáo khoa học: "Multiple cavernous malformations presenting in a patient with Poland syndrome: A case report" pptx

báo cáo khoa học: "Multiple cavernous malformations presenting in a patient with Poland syndrome: A case report" pptx

... neurologic or vascular alterations A physical examination revealed the absence of his right breast and right pectoralis major muscles (Figure 1A) and right-handed symbrachydactyly, status post -multiple ... hypertension and Poland syndrome His mother had had chronic obstructive pulmonary disease and had a heart attack at age 64, which caused her death The rest of the patient’s family history was negative ... (black arrow) Lizarraga and De Salles Journal of Medical Case Reports 2011, 5:469 http://www.jmedicalcasereports.com/content/5/1/469 contralateral to his chest wall and hand defects A mechanistic...

Ngày tải lên: 10/08/2014, 23:20

4 249 0
Creating a one-to-many Map doc

Creating a one-to-many Map doc

... of values, which allows multiple mappings of values to a single key and mappings of a single value to multiple keys As an added feature, a key can also be mapped to a null value Here’s what happens ... MultiMap class presented here operates similarly to a Dictionary The MultiMap class contains a Dictionary field called map that contains the actual mapping of keys to values ... value at any time However, if you need to associate multiple values with a single key, you must use the approach used by the MultiMap class The private map field associates a key with a...

Ngày tải lên: 12/08/2014, 09:22

88 254 0
w