... ongoing, 168; during tough economic times, 176 financial modes: and excelling, 107; and maintaining, 107; and survival, 107–8; and thriving, 107–8 Financial Wheel, 100, 102, 106, 108, 110–11, 156, 184 ... earning, 158, 160; and expenses, 152; and financial intimacy, 149– 51; financial policies, 152; and Financial Wheel, 110, 156, 158–60, 162; investment decisions, 153–54, 157, 159; and money, 166; ... 31 American Academy of Matrimonial Lawyers, 73 American Civil Liberties Union (ACLU), 56 American Dream, 174 American family life: change in, 24–26, 166 American International Group (AIG), 173...
Ngày tải lên: 08/01/2020, 10:06
... men and women from five reno- vated PC centers (Apenins-Montigalà, Morera-Pomar, Mont- gat-Tiana, Nova Lloreda, and La Riera) that are managed by a health management organization (Badalona Serveis ... Raquel Larios 4 , Soledad Velasco 4 and Carme Villarroya 4 1 Directorate of Planning, Badalona Serveis Assistencials, C. Gaietà Soler, 6-8 entresuelo, Badalona, Barcelona, 08911, Spain 2 Department ... primary care settings under routine medical practice: a claim database cost and burden of illness study Antoni Sicras-Mainar 1 , Javier Rejas 2 , Ruth Navarro 1 , Milagrosa Blanca 3 , Ángela...
Ngày tải lên: 09/08/2014, 14:20
Báo cáo y học: " Paliperidone ER and oral risperidone in patients with schizophrenia: a comparative database analysis" pptx
... http://www.biomedcentral.com/1471-244X/11/21/prepub doi:10.1186/1471-244X-11-21 Cite this article as: Turkoz et al.: Paliperidone ER and oral risperidone in patients with schizophrenia: a comparative database analysis. ... individual patient-level data are available. Turkoz et al. BMC Psychiatry 2011, 11:21 http://www.biomedcentral.com/1471-244X/11/21 Page 7 of 10 A literature search (through December 31, 2009) ... matches and av ailable Turkoz et al. BMC Psychiatry 2011, 11:21 http://www.biomedcentral.com/1471-244X/11/21 Page 2 of 10 sample sizes were evaluated to determine the matching algorithm used to create...
Ngày tải lên: 11/08/2014, 16:23
Báo cáo y học: " Local therapy with CpG motifs in a murine model of allergic airway inflammation in IFN-β knock-out mice" doc
... 55:32-43 Satoh Y, Kasama K, Kuwabara M, Yimin, Diao HY, Nakajima H, Kohanawa M, Minagawa T: Suppression of late asthmatic response by low-dose... 111:550-557 Hayashi T, Adachi Y, Hasegawa K, Morimoto ... Victor Matheu* 1,2 , Alexandra Treschow 1 , Ingrid Teige 1 , Vaidrius Navikas 1 and Shohreh Issazadeh-Navikas 1 Address: 1 Section of Medical Inflammation Research, Department of Cell & Molecular ... Buurman WA, Echtenacher B, Hehlgans T, Mannel DN: Antimetastatic effect of CpG DNA mediated by type I IFN Cancer Res 2001, 61:5523-5528 Nakajima H, Nakao A, Watanabe Y, Yoshida S, Iwamoto...
Ngày tải lên: 12/08/2014, 18:21
Using the Renesas Graphics API to Create a User Interface
... 500µA/MHz, 35µA deep standby Industrial, 40nm 200µA/MHz, 0.3µA deep standby Industrial, 90nm 1mA/MHz, 100µA standby Industrial & Automotive, 130nm 144µA/MHz, 0.2µA standby 2010 ... Renesas Electronics America Inc. © 2012 Renesas Electronics America Inc. All rights reserved. Using the Renesas Graphics API to Create a User Interface © 2012 Renesas Electronics America Inc. All ... standby Industrial, 90nm 200µA/MHz, 1.6µA deep standby Automotive & Industrial, 90nm 600µA/MHz, 1.5µA standby Automotive & Industrial, 65nm 600µA/MHz, 1.5µA standby Automotive,...
Ngày tải lên: 22/06/2015, 14:17
Using the Renesas Graphics API to Create a User Interface_Part2_LabProcedure
... LAB PROCEDURE Using the Reneas Graphics API to create a user interface V1.0 Page 1 of 10 Graphics Lab: Using the Renesas Graphics API to Create a User Interface – Part 2 RX TFT-LCD ... Lab Objectives 1. Learn a method to create GUI graphics 2. Use GAPI and application framework on an embedded platform to create a user interface. 3. Understand callback function interaction. ... this lab session is to introduce you the Renesas Graphics API (GAPI) and associated application framework. We will start with an introduction to frame based graphics and basic GAPI calls, than...
Ngày tải lên: 22/06/2015, 14:17
Cosmological model with a local void and observational constraints
... replace above statement with values of alpha_in and % alpha_out R=0.69; % Hubble rates' ratio omega_min=0; omega_max=2; % omega_out's value range delta_omega=0.01; % omega_out's jump step lambda_min=-1;lambda_max=1; ... data=load('SCPUnion.txt'); z=data(:,1); muy=data(:,2); sigma_muy=data(:,3); % % set parameters c=3e5; z1=0.23; % redshift of boundary; z_max=max(z); alpha=1; % clumpiness parameter; % in case ... lambda_min=-1;lambda_max=1; % omega_lambda's value range Thereafter, we use the standard values of parameters R , α , z1 and matter density profile For other cases, we simply change the old values...
Ngày tải lên: 16/10/2015, 15:34
Storytelling with Photographs How to Create a Photo Essay Anne Darling
... Angkor Photo Festival Athens Photo Festival Atlanta Celebrates Photography Auckland Festival of Photography Ballarat International Foto Biennale Belfast Photo Festival Belo Horizonte International Photography Festival (FIF-BH) ... on earth, Thailand, south Sudan and more http://www.paulaphoto.com/ David Alan Harvey: a member of Magnum who has done a lot of work for National Geographic magazine He also runs a magazine called Burn which showcases the work of ... Zed Nelson - http://www.zednelson.com/?GunNation:1 - Guns IPA - http://invisiblephotographer.asia/2011/10/13/reminders-project-asianphotographers-grant-finalist-1-gmb-akash/ - Sex workers in Bangladesh - GMB Akash SDN - http://socialdocumentary.net/exhibit/fran_Antmann/2656 - Maya Healers...
Ngày tải lên: 30/07/2017, 19:26
2.1.4.7 Lab - Establishing a Console Session with Tera Term - ILM
... Serial 0/1/1 (S0/1/1) 2811 Fast Ethernet 0/0 (F0/0) Fast Ethernet 0/1 (F0/1) Serial 0/0/0 (S0/0/0) Serial 0/0/1 (S0/0/1) 2900 Gigabit Ethernet 0/0 (G0/0) Gigabit Ethernet 0/1 (G0/1) Serial 0/0/0 ... 0/0/1 (S0/0/1) 1900 Gigabit Ethernet 0/0 (G0/0) Gigabit Ethernet 0/1 (G0/1) Serial 0/0/0 (S0/0/0) Serial 0/0/1 (S0/0/1) 2801 Fast Ethernet 0/0 (F0/0) Fast Ethernet 0/1 (F0/1) Serial 0/1/0 (S0/1/0) ... Public Page of 11 Lab - Establishing a Console Session with Tera Term http://www.cisco.com/cisco/software/release.html? mdfid=282774238&flowid=714&softwareid=282855122&release=3.1&relind=AVAILABLE&rellifecycle=&reltyp...
Ngày tải lên: 15/12/2017, 18:27
Apache cassandra essentials create your own massively scalable cassandra database with highly responsive database queries
... configuration files about / Configuration files cassandra.yaml / cassandra.yaml cluster configurations / cassandra.yaml data partitioning / cassandra.yaml storage configurations / cassandra.yaml ... Cassandra JSON utility external data, loading / Loading external data into Cassandra Cassandra caches configuring / Configuring Cassandra caches Key cache / Configuring Cassandra caches Row cache ... coordinator node about / Cassandra cluster overview counters about / Counters limitation / Counters D database about / A database and schema keyspace / A database and schema, Keyspace column family /...
Ngày tải lên: 04/03/2019, 14:28
Packt drupal 5 themes create a new theme for your drupal website with a clean layout and powerful CSS styling dec 2007 ISBN 1847191827 pdf
... template.php File Modifying the PHPTemplate Engine Files Placing Overrides in Dedicated Files Intercepting Template Files Summary 101 101 103 105 106 107 108 109 110 111 111 112 113 113 116 117 ... footer 165 header region, header wrapper 161 header wrapper 159 help, main content area 163 logo, header wrapper 159 main content area, main wrapper 162 main wrapper 162 messages, main content area ... headers 196 main content area 199 main content area, breadcrumb trail 199 main content area, content Region 200 main content area, help 199 main content area, messages 200 main content area, tabs 199...
Ngày tải lên: 20/03/2019, 11:52
Ebook Local and regional flaps in head & neck reconstruction - A practical approach: Part 1
... Crescentic flap 20 Septal flap 31 Nasolabial flap 41 V to Y advancement flap 50 Keystone flap 57 10 Paramedian forehead flap 62 11 The temporoparietal fascia flap 75 12 Temporalis muscle flap 84 13 Cervicofacial ... Cervicofacial advancement flap 92 14 Submental island flap 103 15 Pectoralis major myocutaneous flap 114 16 Latissimus dorsi myocutaneous flap 123 17 Sternocleidomastoid flap 133 18 Trapezius flap 140 ... experimental and clinical correlation Plast Reconstr Surg 1981; 67:177–187 91 Nakajima H, Imanishi N, Minabe T The arterial anatomy of the temporal region and the vascular basis of various temporal flaps...
Ngày tải lên: 20/01/2020, 23:09
MCSA 2012: Local user account và local group
... https://cuongquach.com/mcsa-2012-local-user-account-va-local-group.html 1/18 23/4/2019 MCSA 2012: Local User Account Local Group - Technology Diver User Account – Local User Account 1.1 Local User Accounts ... https://cuongquach.com/mcsa-2012-local-user-account-va-local-group.html 17/18 23/4/2019 MCSA 2012: Local User Account Local Group - Technology Diver https://cuongquach.com/mcsa-2012-local-user-account-va-local-group.html ... “Computer Management” > “Local Users and Groups” > “Users“ https://cuongquach.com/mcsa-2012-local-user-account-va-local-group.html 13/18 23/4/2019 MCSA 2012: Local User Account Local Group -...
Ngày tải lên: 08/07/2020, 11:59
Excellent local control with IOERT and postoperative EBRT in high grade extremity sarcoma: Results from a subgroup analysis of a prospective trial
... rate (1-8%) with [14,38] or without IOERT [31,39,40] as part of radiation therapy However, as fractures may occur many years after the end of radiation treatment as highlighted by a large analysis ... recall dermatitis, but did not find an association with a particular substance or substance group However, based on the rare available data, adriamycin seems to be one of the substances with an ... Table Patient characteristics Patient characteristics N % Age Median 52 Min 37 Max 65 Gender Male 23 68 Female 11 32 Upper limb 12 Lower limb 30 88 Liposarcoma 10 29 Synovial sarcoma 21 NOS 18...
Ngày tải lên: 05/11/2020, 00:29
Early versus deferred androgen suppression therapy for patients with lymph node-positive prostate cancer after local therapy with curative intent: A systematic review
... prostate Page 12 of 13 10 11 12 13 14 15 16 17 18 19 20 21 22 cancer Part II: Treatment of advanced, relapsing, and castration-resistant prostate cancer Eur Urol 2011, 59(4):572–583 Parmar MK, ... CENTRAL (Cochrane Library 2011/Issue 2), MEDLINE (Ovid, 1946-02/2011), and EMBASE (DIMDI, 1947-02/ 2011) databases The search strategy was adapted for each electronic database (Table 1) Second, ... 58(6):843–848 40 Miyamae K, Kitani K, Miyamoto K, Hamada S, Kawano T, Maehara A, Otsuka Y, Otsuka T, Hamada Y: [Evaluation of immediate androgen deprivation adjuvant therapy in patients with lymph node...
Ngày tải lên: 05/11/2020, 07:26
Brief history of local government in Vietnam (1946 – 2000) - a preliminary comparison with china and the united states
... HISTORY OF LOCAL GOVERNMENT IN VIETNAM (1946 – 2000): A PRELIMINARY COMPARISON WITH CHINA AND THE UNITED STATES Pham Quang Huy Abstract: On the basis of presentation and analysis with respect ... văn hóa, 1972), 175 After the last amendment in 1797 (after 132 years), it included 82 articles 12 Legally, in contractual perspective, laws of village were regarded to community covenant13 1946 ... Social Commission for Asia and the Pacific (2014), Local Government in Asia and the Pacific: A Comparative Study, United Nations Economic and Social Commission for Asia and the Pacific website, see...
Ngày tải lên: 23/01/2021, 19:20
slide 1 this is thuy’s house 6 a lake a rice paddy a flower a river a tree a hotel 1 new words a park a yard a lake a rice paddy flowers 1 3 5 6 2 match the words with the pictures a river a yard 2 4
... ……… B : ariver, a lake , a park, a hotel and a rice paddy A : a river, a lake , a park, a hotel and a school C : a river, a lake , a park, a hotel and a street 4) Thuy’s……… is Minh A : sister ... C : a house B : an apartment A : a flat Choose the best ansers ( A, B or C ) for each sentence (16)- Learn vocabulary and structures by heart. - Learn vocabulary and structures by heart. ... What’s there, near house? a)She is twelve She is a student c,What is her brother’s name ? (12)(13)(14)Our house has a It is near a There is a near the There is a and a There are and...
Ngày tải lên: 13/04/2021, 18:36
Application of anammox process for nitrogen removal from old leachate by IC technology in a pilot scale with capacity of 1 m 3 day
... 1290 1280 1369 954 1100 964 996 1026 1044 1044 944 944 1050 1012 1018 1068 1044 1040 882 1024 1008 990 990 1020 1160 1492 1276 1110 1096 1018 1112 1080 1024 992 936 1011 1104 1114 1102 1010 994 1000 ... 0,01 0,01 0,01 0,00 0,01 0,01 0,01 0,01 0,01 0,01 0,00 0,01 0,01 0,01 0,01 0,01 0,01 0,01 0,01 0,01 0,01 0,01 0,01 0,01 0,01 0,01 0,01 0,01 0,01 0,01 0,01 99 100 101 102 103 104 105 106 7,0 7,1 ... 1216 1212 1228 1302 1056 1060 1040 1000 1004 1032 1036 888 896 1018 1016 968 996 976 972 880 960 1016 1070 1070 1040 1000 77 1,79 4,30 1,61 0,30 1,10 0,93 2,31 4,30 2,33 1,22 2,43 1,30 1,47 1,36...
Ngày tải lên: 27/04/2021, 11:07
factors associated with the control of viral replication and virologic breakthrough in a recently infected hiv 1 controller
... minutes at 68°C followed AC by a 4°C hold (Outer Primers: 5’-GTAGCTGAGGGGACAGATAGGGTTAT, 3’GCACTCAAGGCAAGCTTTATTGAGGC; Inner Primers: 5’-CGTCTAGAACATACCTAGAAGAATAAGACAGG, 3’CGGAATCCGTCCCCAGCGGAAAGTCCCTTGTA) ... hold (Primers: 5’- GCGAGAGCGTCAGTATTAAGC, 3’-TCTTTATCTAAGGGAACTGAAAAATATGCATC) Inner gag amplification: 94°C for minutes; 34 cycles of 30 seconds at 94°C, 30 seconds of 50°C, and PT minutes 45 seconds ... S2352-3964(17)30038-5 doi: 10.1016/j.ebiom.2017.01.034 EBIOM 938 To appear in: EBioMedicine Received date: Revised date: Accepted date: July 2016 18 January 2017 25 January 2017 Please cite this article...
Ngày tải lên: 04/12/2022, 10:29
Bạn có muốn tìm thêm với từ khóa: