construct a sentiment sensitive thesaurus

Tài liệu Báo cáo khoa học: "Using Multiple Sources to Construct a Sentiment Sensitive Thesaurus for Cross-Domain Sentiment Classification" doc

Tài liệu Báo cáo khoa học: "Using Multiple Sources to Construct a Sentiment Sensitive Thesaurus for Cross-Domain Sentiment Classification" doc

... learning techniques. In EMNLP 2002, pages 79– 86. Patrick Pantel and Deepak Ravichandran. 2004. Au- tomatically labeling semantic classes. In NAACL- HLT’04, pages 321 – 328. Sunita Sarawagi and ... mining and sentiment analysis. Foundations and Trends in Infor- mation Retrieval, 2(1-2):1–135. Bo Pang, Lillian Lee, and Shivakumar Vaithyanathan. 2002. Thumbs up? sentiment classification using ma- chine ... reviews are sensitive to sentiment labels assigned to reviews in the source domain. Using a sparse matrix format and approximate similarity matching techniques (Sarawagi and Kirpal, 2004), we can...

Ngày tải lên: 20/02/2014, 04:20

10 557 0
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV-1 10482 10661 179 1G4P217 Group 4 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 104 382 279 1G5P30 Group 5 TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT DENV-4 ... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV-1 92.1 ± 0.57 73.6 ± 2.31 1G4P217 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 90.3 ± 1.09 83.9 ± 5.16 1G5P30 TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT DENV-4 81.8 ... CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT DENV-2 98.9 ± 6.23 98.9 ± 6.23 2G2P5 GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC DENV-2 98.4 ± 0.84 98.4 ± 0.84 1G3P6 CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV-1...

Ngày tải lên: 14/02/2014, 19:20

12 799 0
Tài liệu COUNSELING and PSYCHOTHERAPY with ARABS and MUSLIMS A Culturally Sensitive Approach doc

Tài liệu COUNSELING and PSYCHOTHERAPY with ARABS and MUSLIMS A Culturally Sensitive Approach doc

... earth. “Wabtagi fema a tak Allah al-dar el-aakhera wala tansa nasibak men al-dunia” (Al-Qusas #77). [But seek, by means of that which God has given you, to attain the abode of the hereafter and ... and avoid hopelessness, by employing the verse, “Faasa an takrahou shaiaan wayajaalu Allah menhu khayran kathera” (Al-nisaa #19). [It may well be that you dislike a thing which God has meant ... katab Allah lana howa mawlana waala Allah falyatawakal el-moamenin” (Al-tawbah #51). [Say: Nothing will befall us except what God has ordained. He is our Guardian. In God let the faithful put...

Ngày tải lên: 15/02/2014, 15:20

187 333 0
Tài liệu Báo cáo khoa học: "Liars and Saviors in a Sentiment Annotated Corpus of Comments to Political debates" pdf

Tài liệu Báo cáo khoa học: "Liars and Saviors in a Sentiment Annotated Corpus of Comments to Political debates" pdf

... potentially involved (Riloff and Wiebe., 2003; Sarmento et al., 2009). Alternative approaches to automatic and manual construction of sentiment corpora have been pro- posed. For example, Kim and ... corpus annotations supports the annotation scheme proposed and helps to iden- tify directions for future work in this research area. 2 Related Work MPQA is an example of a manually annotated sentiment ... Natu- ral Language Processing and Computational Natural Language Learning, Prague. Krippendorff, Klaus. 2004. Content Analysis: An Intro- duction to Its Methodology, 2 nd Edition. Sage Publi- cations,...

Ngày tải lên: 20/02/2014, 05:20

5 506 0
Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf

Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf

... ex- presses negative valence and neutral arousal. After checking the posts, we have learned that it is be- cause the Japanese volcano Mount Asama has con- tinued to erupt. Some users are worried and discussed ... We also integrate the sentiment- detection system with a real-time rule-based harmonic music and animation generator to display streams of messages in an audiovisual format.  Conceptually, ... generating music melody au- tomatically based on detected sentiments, and (3) produce an animation of real-time piano playing for audiovisual display. Our MemeTube system can be accessed via:...

Ngày tải lên: 20/02/2014, 05:20

6 449 0
Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf

Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf

... GTCGGATC CGCGGATCAGGTGGGGATGTATTA; rnc5¢I comp, GGCAGTGGATGATGGGGTTCATGCGATACC; rnc3¢O SalI, TGCGTCGACATTTGCCGCAATAGTGTCAACA; and rnc3¢I comp, TGAACCCCATCATCCACTGCCAG GTCAGCG. The deletion was constructed ... follows: era_F_NcoI, CGACCATGGCGAAC AGGCGTTGAAAAAAC; and era_R_SalI, CGAGTCGA CAGCCTTCCATCGGAGTTACT. The resulting vector was termed pTrc9 9a: :era. Protein overexpression was assayed by SDS ⁄ PAGE. Selection ... to 60% at the same Mg 2+ concentrations. When the traces and the quantification of peak areas in JB69 and SQZ10 were examined, it appeared that there was a stoichoimetric imbalance of 30S and 50S...

Ngày tải lên: 06/03/2014, 00:21

12 439 0
Báo cáo khoa học: "A Cost Sensitive Part-of-Speech Tagging: Differentiating Serious Errors from Minor Errors" pptx

Báo cáo khoa học: "A Cost Sensitive Part-of-Speech Tagging: Differentiating Serious Errors from Minor Errors" pptx

... Conference on Com- putational Natural Language Learning. pp. 296–305. Taku Kudo, Kaoru Yamamoto, and Yuji Matsumoto. 2004. Applying Conditional Random Fields to Japanese Morphological Analysis. In Proceedings ... Linguis- tics. pp. 744–751. Joao Graca, Kuzman Ganchev, Ben Taskar, and Fernando Pereira. 2009. Posterior vs Parameter Sparsity in La- tent Variable Models. In Advances in Neural Informa- tion Processing ... 48–52. Drahom´ıra “johanka” Spoustov `a, Jan Hajiˇc, Jan Raab, and Miroslav Spousta 2009. Semi-supervised training for the averaged perceptron POS tagger. In Proceed- ings of the European Chapter...

Ngày tải lên: 07/03/2014, 18:20

10 407 0
Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc

Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc

... the transcription initiation site a TATA- like sequence (TAAATA) is located between base pairs )28 and )23. A CCAAT-consensus box is located at )86 bp (CCAAT), a reverse CCAAT motif lies at )825 ... stranded oligonucleotides spanning the region from )70 to )36 of t he xMGP promoter (5¢-GATCCAGGGGAGGGAAAACAAGGA GATGAGGAGGTGTGGT-3¢,and5¢-GATCTACCA CACCTCCTCATCTCCTTGTTTTCCCTCCCCTG-3¢) as BamHI/BglII ... constructs )180/)36TATALUC and )180/)72TATALUC were gen- erated by PCR amplification with a common, sense oligonucleotide ( 5¢-CG GGATCCCAATCTGTTGCTAA TTAGG-3¢)andthe3¢ specific oligonucleotides (5¢-GA AGATCTACCACACCTCCTCATCTCC-3¢)...

Ngày tải lên: 08/03/2014, 10:20

10 475 0
Báo cáo khoa học: "A Sentiment Analyzer for Micro-blogs" potx

Báo cáo khoa học: "A Sentiment Analyzer for Micro-blogs" potx

... Micro-blogs Aditya Joshi 1 Balamurali A R 2 Pushpak Bhattacharyya 1 Rajat Mohanty 3 1 Dept. of Computer Science and Engineering, IIT Bombay, Mumbai 2 IITB-Monash Research Academy, IIT Bombay, Mumbai 3 AOL ... Akshat Malu and Subhabrata Mukherjee, IIT Bombay for their assistance during generation of evalua- tion data. References Go Alec, Huang Lei, and Bhayani Richa. 200 9a. Twit- ter sentiment classification ... Analysis. MIT Press. Maite Taboada and Jack Grieve. 2004. Analyzing Ap- praisal Automatically. In Proceedings of the AAAI Spring Symposium on Exploring Attitude and Affect in Text: Theories and...

Ngày tải lên: 17/03/2014, 00:20

6 247 0
Báo cáo khoa học: "A Morphologically Sensitive Clustering Algorithm for Identifying Arabic Roots" docx

Báo cáo khoa học: "A Morphologically Sensitive Clustering Algorithm for Identifying Arabic Roots" docx

... semantically related pairs of words and document titles. Information Storage and Retrieval,. Vol 10, pp 253-260 Al-Fedaghi Sabah S. and Fawaz Al-Anzi (1989) A new algorithm to generate Arabic ... identification on a scale useful for IR remains problematic. Research on Arabic IR tends to treat automatic indexing and stemming separately. Al-Shalabi and Evans (1998) and El-Sadany and Hashish (1989) ... Adamson's algorithm on Arabic data to assess its ability to cluster words sharing a root. Each of the data sets was clustered manually to provide an ideal benchmark. This task was executed by a...

Ngày tải lên: 17/03/2014, 07:20

8 264 0
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

... 56-kilodalton protease. Infect Immun 58, 1269–1272. 7 Tanaka H, Yamamoto T, Shibuya Y, Nishino N, Tanase S, Miyauchi Y & Kambara T (1992) Activation of human plasma prekallikrein by Pseudomonas aerugi- nosa ... zinc- metalloproteinase from Serratia marcescens. Biochim Biophys Acta 955, 77–85. 6 Oda T, Kojima Y, Akaike T, Ijiri S, Molla A & Maeda H (1990) Inactivation of chemotactic activity of C 5a by the serratial ... proteases in the latter sub- family, beside the $ 56 kDa metallo-endoprotease of Serratia marcescens (serralysin), are the alkaline protei- nase of Pseudomonas aeruginosa, the ZapA metallo- protease...

Ngày tải lên: 23/03/2014, 09:20

11 429 0
Oxford Thesaurus - An A-Z Dictionary Of Synonyms

Oxford Thesaurus - An A-Z Dictionary Of Synonyms

... thousands of feet. adaptable adj. flexible, pliable, pliant, compliant, accommodative, tractable, malleable, ductile, versatile; alterable, changeable: Men, in general, are not as adaptable as ... 1.9 alarm 1.10 amalgam 1.11 anachronism 1.12 apart 1.13 arbitrary 1.14 ashamed 1.15 atmosphere 1.16 audacious 1.17 available 1.18 awake 1.19 B 2.0 babble 2.1 beach 2.2 bias 2.3 blab ... abominable. aboriginal n. native, indigene, autochthon; Colloq Australian Abo, Offensive Australian aborigine , Slang Australian contemptuous boong: Many aboriginals are not assimilated to...

Ngày tải lên: 19/08/2013, 09:54

2,1K 677 1

Bạn có muốn tìm thêm với từ khóa:

w