semantic links on a thesaurus

... International Standards transparently to the maximum extent possible in their national and regional standards Any divergence between the IEC Standard and the corresponding national or regional standard ... également aux travaux La CE1 collabore étroitement avec l'organisation lpternationale de Normalisation (ISO), selon des conditions fixées par accord entre les deux organisations 2) Les décisions ... organisation mondiale de normalisation composée de l'ensemble des comités électrotechniques nationaux (Comités nationaux de la CEI) La CE1 a pour objet de favoriser la coopération internationale

Ngày tải lên: 25/12/2013, 10:59

... Trang 2Révision de la présente publication Le contenu technique des publications de la C E I est constam- ment revu par la Commission afin d'assurer qu'il reflete bien l'état actuel de la technique ... publications d e la C E I préparées par le Comité d'Etudes qui a établi la présente publication Revision of this publication The technical content of I E C publications is kept under con- stant ... d'installation Quand l e r i s q u e d e propagation est élevg, p a r exemple le long de nappes verticales d e conduc- teurs, on n e p e u t assurer que, même s i un échantillon est façon semblable

Ngày tải lên: 25/12/2013, 10:59

... server-based authentications is preauthentication Preauthentication is an optional part of the 802.11i amendment, so there are a number of stations and APs that lack support for it Those Trang 8sta-tions ... PMK caching is that the initial association to each AP on the wireless LAN still requires a full 802.1X/EAP authentication so that a PMK can be created This means that PMK caching only enables ... accompany that data In addition, Wi-Fi networks have a random backoff sequence that allows a wireless AP and the stations that connect to it to share a wireless channel Since a detailed discussion of

Ngày tải lên: 24/01/2014, 09:20

... files and Web Distributed Authoring and Versioning (WebDAV) access
Configuring Authentication for a Web Server Explain each of the authentication methods with an emphasis on Anonymous, Basic, and ... users that are authenticated by Basic authentication must log on by using a valid Windows user name and password The user name usually includes a Windows domain name and an account user name These ... users, that allow them to gain access to and manipulate data on a server By effectively managing permissions, you can control a user’s actions on Web server content IIS uses several types of

Ngày tải lên: 24/01/2014, 10:20

... was immediatelypushed off from shore, and was soon alongside a pleasure-yacht, thatwas lying to, not many cable lengths away wen-At a sign from Servadac, an orderly, who had been standing at a ... was a native of Algeria; but such was by no means thecase His true name was Laurent; he was a native of Montmartre in Paris,and how or why he had obtained his patronymic was one of those anom-alies ... dates, and oranges from the plantations thatformed a continuous rich and luxuriant orchard along their path Thedistrict was quite deserted, and they had no reason to fear any legalpenalty In an

Ngày tải lên: 17/02/2014, 04:20

... dissolution of his elementary parts; as was the case,in Venice, of the procurator Thomas Contarini; and in Padua, of the cavalier Antonio Capo di Vacca But it isnot one man in a hundred thousand, that ... considering, that what exceeds this, is disease and death, andmerely gives the palate satisfaction, which, though but momentary, brings on the body a long and lasting train of disagreeable sensations and ... that, to me, the habit of it was become a second nature; and that it wasmore agreeable to reason, that, as I advanced in years and lost my strength, I should rather lessen than increasethe quantity

Ngày tải lên: 17/02/2014, 22:20

... technological mandates and instead enhance funding and encourage collaborative, faceted, and multi-stakeholder initiatives and approaches to enhance online safety via innovation and cooperation multi-recommendations ... been a significant move away from a rather fear-based approach and [toward] using more research of actual harm.” Balkam said there are still some challenges “Some companies are rather disconnected ... opinion and fiction And in a social-media environment, media literacy has a new essential component: critical thinking about what is posted, shared, produced and uploaded as well as content that’s

Ngày tải lên: 18/02/2014, 00:20

... no means in a conformation that is fit to activate The fact that kcatand Km for tRNAArgin the aminoacylation reaction do not change in the Asn106 fi Ala, Gln111 fi Ala and Phe109 fi Ala mutants of ... molecular mechanism for the tRNA synthetase-catalyzed deacylation of Arg-tRNA (Arg-Arg-tRNA + AMP fi Arg-AMP + tRNA at high pH), in which the deacylation of aminoacyl-tRNA bound on Arg-tRNA synthetase ... the ternary complex of S cerevisiae ArgRS, Arg and tRNAArgICG grow contains tRNA, l-Arg, ATP and Mg2+ at sufficient concentrations for the aminoacyla-tion reacaminoacyla-tion, and (NH4)2SO4 and 1,6-hexanediol

Ngày tải lên: 18/02/2014, 11:20

... (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) containing a BamHI site. The gene was cloned at the NheI and BamHI sites ... S, Khachatr- yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotoga maritima stationary phase survival protein SurE: a novel acid phosphatase. Structure ... survival operon regulated by the stationary-phase RNA polymerase alternative sigma factor. SurE is known to improve bacterial viability during stress conditions. It functions as a phosphatase specific

Ngày tải lên: 18/02/2014, 14:20

... Annals of Mathematics On a vanishing conjecture appearing in the geometric Langlands correspondence By D Gaitsgory Annals of Mathematics, 160 (2004), 617–682 On a vanishing conjecture appearing ... representation with m > n, has an analytic continuation and satisfies a functional equation More precisely, let X be a curve over a finite field, and K the corresponding global field Then it is known that ... sequel, the vanishing of the functor Avd E is analogous to the condition that the Rankin-Selberg convolution of E, viewed as an m-dimensional Galois representation, and an automorphic form on GLn with

Ngày tải lên: 05/03/2014, 23:20

... i.e., maximal abelian ∗ -subalgebras A ⊂ M such that M has the property H relative to A and A contains a subalgebra A0 ⊂ A with sub-A 0∩M = A and A0 ⊂ M rigid We then prove the main technical result ... relative to a maximal abelian subalgebra A ⊂ M then A is a Cartan subalgebra of M In Section 4 we define a notion of rigidity (or relative property (T)) for inclusions of algebras and investigate ... ergodic action of SL(2, Z) on an abelian algebra A1, is in the class HT By a recent result in [Hj], based on the notion and results on tree-ability in [G1], allthese factors are in fact amplifications

Ngày tải lên: 06/03/2014, 08:21

... and antisense primer sequences were 5¢-TGTGAGT CCATTAATCGATGAAACC-3¢ and 5¢-ACCTGATCG CTTGGCATCTG-3¢, respectively The probe sequence was as follows: (FAM)-AGCTGATGCTATTCAAACTCGA ACGCCTCT-(TAMRA) ... increasing concentrations (2–10 lM) of ionomycin The increase in intracellular Ca2+ concentrations was analyzed by scanning fluorometry After that time period, mM Ca2+ and ionomycin (to a final concentration ... intracellular Ca2+ concentrations (the mean values and standard deviations of three experiments are shown) (C) As measured by lactate dehydrogenase assays, treatment of A172 cells with lM ionomycin

Ngày tải lên: 07/03/2014, 05:20

... representation and as propor-tional covers for statistical analysis Repeated-measures analysis of variance (ANOVA) was used to compare the proportional covers of individual substrate components amongsamplingdates ... the manuscript, as did the comments of an anonymous reviewer M.A.Toscano acknowledges the assistance of R.P Stumpf (NOAA/National Ocean Service) and K.S Casey (NOAA/National Oceanographic Data Center) ... (Day+Night) Pathfinder values for the Channel Cay area increased the number of available SST measurements by a factor of two over Night data alone Day+ Night data also gave us a more valid basis

Ngày tải lên: 07/03/2014, 17:20

... there, and every advantageGod hath given us? Is not a game a kind of mimic war, and shall not a man use skill and stratagem in games? Go to, lad Am I a common coney-catcher? Do I cheat with a gang? ... weapons, and tocall "Ho, within!" The mansion beyond the wall was a timbered one, its gables backed by trees It had no park, and its wallenclosed also a small orchard at the rear, and a ... player!" Old Anthony had drawn back from Hal, vastly scandalized, his eyes raised heavenward as if for divine protection from contamination; and the physician gazed, in a kind of passionless

Ngày tải lên: 08/03/2014, 13:20

... (Guatemala), La Liga de la Leche Materna (Honduras), Asociación Hondureña de Lactancia Materna (AHLACMA), CALMA (El Salvador), the Breast Is Best League (Belize), the Ghana Association of Infant ... Guatemala, Guatemala City, Guatemala Dr Hernán Delgado, Director, Institute of Nutrition of Central America and Panama (INCAP), Guatemala City, Guatemala Dr Cutberto Garza, Professor, Division ... the availability and preparation of adequate and safe complementary foods —Patience Mensah and Andrew Tomkins 104 Conclusions of the Global Consultation on Complementary Feeding —Bernadette Daelmans,

Ngày tải lên: 08/03/2014, 23:20

... Trang 1On a coloring conjecture about unit fractions By Ernest S Croot III Trang 2On a coloring conjecture about unit fractions By Ernest S Croot III Abstract We prove an old conjecture ... much smaller; also note that b cannot be taken to be smaller than e, since the integers in [2, e r −o(r)] can be placed into r classes in such a way that the sum of reciprocals in each class is ... > 1. From this lemma and partial summation we have, for a fixed u and δ,  N <n<N 1+δ pa||n⇒pa≤N1/u 1 n ∼ log N u  u(1+δ) u ρ(w)dw. Using this, a numerical calculation shows for N = exp(163550r),

Ngày tải lên: 14/03/2014, 22:20

... Whereas the association‟s ownership share in Helaba increased to 85%, LBB was 98% taken over by means of a complex arrangement by the German Savings Banks Association Trang 8financial sector and ... municipal, state, association, federal policies and European competition policy, an open and critical public debate is of particular relevance Taken as a whole, Landesbanks and savings banks currently ... the abolition of state guarantees (“Anstaltslast und und Gewähr- trägerhaftung”)is still unresolved, as neither the interbank market nor the capital market makes funds available on reasonable

Ngày tải lên: 15/03/2014, 10:20

... reaccondensa-tion on the DEBS becomes an addicondensa-tional bottleneck with an unnatural starter acid provides a rational basis for efforts to improve productivity Thus, alteration of the AT domain ... molecular mass of 32582 Da and the second has a molecular mass of 32739 Da As expected, after incubation with methyl-malonyl-CoA, both fragments showed two extra peaks at 32684 and 32839 Da, respectively, ... during catalysis [22,23] Both animal FAS and modular PKS are functional homodimers, which raises additional questions about the interactions between the active sites of an identical pair of modules

Ngày tải lên: 16/03/2014, 03:20

... (Alternatively, as soon as funds allow and you are able to make it happen). Hands-on work, defining and planning for travel in such a way that it will convey an actual goal or goals, destinations, budgets and ... Consult many of them and check often for new and helpful resources in print and online that contains destination-like travel information Save money if you are an AAA member and take advantage ... traveling adults, children and babies is always a good idea as well Foil-packaged, coffee and tea are a necessity... place to start gathering topical, destination and relevant information

Ngày tải lên: 17/03/2014, 03:20

... no escape Patricia Highsmith was born in Texas in America in 1921 She lived in England and France, and finally moved to a village in Switzerland She was an artist as well as a writer, and liked ... man said 'Coffee?' Bruno left and ran to the station He suddenly knew what he really wanted: a woman He wanted a woman He was very excited He asked a taxi-driver where to go The man wrote an address ... place where Miriam would live Bruno waited by a tree near the house After a long time two men and a woman came out The woman had red hair and a square, big body One of the men had red hair, too Her

Ngày tải lên: 20/03/2014, 15:49