connecting the layers in a scene

Praise for Learning Cocos2D pot

Praise for Learning Cocos2D pot

... Hello, Space Viking 23 Creating the SpaceViking Project 23 Creating the Space Viking Classes Creating the Background Layer 24 26 The Gameplay Layer: Adding Ole the Viking to the Game 29 The GameScene ... publisher was aware of a trademark claim, the designations have been printed with initial capital letters or in all capitals The authors and publisher have taken care in the preparation of this ... Images 180 Adding Images and Fonts for the Menus Creating the Main Menu Creating the MainMenuScene MainMenuLayer class 181 182 182 183 Additional Menus and GameplayLayer 190 Importing the Intro,...

Ngày tải lên: 22/03/2014, 15:21

631 1,4K 0
Tài liệu IP Multicast Distribution Trees and Control Protocols docx

Tài liệu IP Multicast Distribution Trees and Control Protocols docx

... into the backbone area Area via MABR2 The routers in the backbone area are forwarding (S2, A) traffic to MABR1, which is sending the traffic into Area towards the receiver MA 2-48 IP Multicast Technology ... area are aware of the existence of members in other areas (Note: Summary Membership LSAs are only injected into the backbone area They are never injected into non-backbone areas.) In the example ... In the example above, sources are located outside Area and Area Because Area1 has members of groups A and B, multicast traffic is forwarded by MASBR through the backbone area Area over MABR1 into...

Ngày tải lên: 11/12/2013, 14:15

116 388 0
Tài liệu Networking and Desktop Protocols docx

Tài liệu Networking and Desktop Protocols docx

... to maintain a static list of all computers available in the network The file typically contains the name and protocol addresses of all servers available in the domain For large networks, the ... security and user account information for an entire domain Each domain must have at least one PDC A workgroup is defined as a logical connection A backup domain controller (BDC) maintains a copy of the ... FDDI interfaces Data Link and Physical Layer The Data Link and Physical layers are designed to provide physical connectivity at an electrical level, that is the Physical layer, and they provide a...

Ngày tải lên: 21/12/2013, 19:15

42 359 0
Tài liệu Irish Economy Note No. 10 “The U.S. and Irish Credit Crises: Their Distinctive Differences and Common Features” ppt

Tài liệu Irish Economy Note No. 10 “The U.S. and Irish Credit Crises: Their Distinctive Differences and Common Features” ppt

... This market feature was almost entirely absent in Ireland where an originate-and-hold loan generation system was dominant The moral hazard in performance-related-pay had a role in both the US and ... Reinhart and Rogoff (2009), a common feature in banking crises is a sustained surge in capital inflows in the run-up period before the crisis Reinhart and Reinhart (200 8a) call this a capital ... gives banks and other financial institutions a moral hazard incentive to increase the riskiness of their balance sheets unduly Moral hazard behaviour associated with deposit insurance is widely assigned...

Ngày tải lên: 15/02/2014, 14:20

26 436 0
The Little Book of SEMAPHORES (2nd Edition)-The Ins and Outs of Concurrency Control and Common Mistakes docx

The Little Book of SEMAPHORES (2nd Edition)-The Ins and Outs of Concurrency Control and Common Mistakes docx

... critical point The only change is another signal after waiting at the barrier Now as each thread passes, it signals the semaphore so that the next thread can pass This pattern, a wait and a signal ... the following execution path a1 < b1 < b2 < a2 Assuming that the initial value of x is 0, what is its final value? Because both threads read the same initial value, they write the same value The ... make the example concrete, imagine that a1 reads a line from a file, and b1 displays the line on the screen The semaphore in this program guarantees that Thread A has completed a1 before Thread...

Ngày tải lên: 15/03/2014, 11:20

291 3,3K 0
BASICS OF MECHANICAL ENGINEERING: INTEGRATING SCIENCE, TECHNOLOGY AND COMMON SENSE potx

BASICS OF MECHANICAL ENGINEERING: INTEGRATING SCIENCE, TECHNOLOGY AND COMMON SENSE potx

... Fi is called the line of action The moment arm is the distance (di again) between the line of action and a line parallel to the line of action that passes through the anchor point Then the moment ... is a distance “c” above the ramp, a 28 distance a behind the front wheels, and a distance “b” in front of the rear wheels The cable is attached to the car a distance “d” above the ramp surface ... y coordinates to the horizontal and vertical directions They can be (for example) parallel and perpendicular to an inclined surface if that appears in the ! problem In fact, the x and y axes don’t...

Ngày tải lên: 18/03/2014, 01:21

131 421 2
Nerves and Common Sense ppt

Nerves and Common Sense ppt

... opportunity and you try the experiment again, and again, and then again, until finally your brain gets the habit of trying the experiment without any voluntary effort on your part That habit being established, ... irritable complaints, and so he is in a way The woman thinks that she has a right to suffer because of her husband's irritable ugliness, and so she has in a way But in the truest way, and the way ... bad really in its essence it is not bad at all If we only give the other man a real chance It is the pushing and pulling and demanding of one human being toward another that smother the best in...

Ngày tải lên: 23/03/2014, 02:20

86 293 0
Báo cáo Y học: Domain organization, folding and stability of bacteriophage T4 fibritin, a segmented coiled-coil protein docx

Báo cáo Y học: Domain organization, folding and stability of bacteriophage T4 fibritin, a segmented coiled-coil protein docx

... that all truncated fibritin molecules, containing the C-terminal domain, had the heat absorption peak (Fig 3A, B) Its enthalpy was approximately equal for all studied fibritin mutants (Fig 3A, internal) ... fibritin did not reveal a heat-adsorption 345 K-peak characteristic for the C-terminal domain, and the protein had three thermal transition peaks centred at 321 K, 329 K, and 336 K (Fig 6A) The main ... and, as it was proposed earlier [5,8,10], it helps to align three chains and serves as a foldon by increasing local chain concentration at the C-terminus In addition, the C-terminal domain of...

Ngày tải lên: 24/03/2014, 03:21

9 369 0
basic dna and rna protocols

basic dna and rna protocols

... to their size in an agarose gel (Chapter 3) The DNA is then partially cleaved by depurination (to facilitate the transfer of larger DNA fragments) and alkali denaturedby sequential soaking of the ... plaques in the normal manner, except that both layers in the plate are made with agarose, not agar, since impurities in the agar will inhibit the PCR reaction Pick mdividual plaques and transfer them ... TTGTA AAACG ACGGC CAGTG 3’ 100 @I PCRRSEQ: 5’ GGAAA CAGCT ATGAC CATGA T 3’ Combme these primers 1: to obtain a 50-w solution of each primer Taq DNA polymerase: Supplied by the manufacturer at a...

Ngày tải lên: 10/04/2014, 11:03

493 396 0
basic protein and peptide protocols

basic protein and peptide protocols

... dialysis Alternatively, they should be included in the reagent blank and calibration standards at the same concentration as in the sample The presence of base in the assay increases absorbance ... Bovine serum albumin Insulin Transferrin Lysozyme a- Chymotrypsinogen Soybean trypsin inhibitor Ovalbumin y-Globulin P-Lactoglobulin A Trypsin Aprotinin Gelatin Gramrcidin S Relative absorbance Assay ... right, the effect on protein overloading of increasing a band’s size (the sample proteins are as in sample, left) Extreme overloading may also cause narrowing of faster-migrating bands, as has happened...

Ngày tải lên: 10/04/2014, 11:03

482 387 0
antigen processing and presentation protocols

antigen processing and presentation protocols

... first day The second day can then be devoted to DEAESepharose chromatography and peptidase assays Assemble the following apparatus at 4°C in a walk -in or chromatography refrigerator Standardize the ... N-acetylleucyl-leucyl-methioninal (calpain inhibitor II) which has similar activity against other cellular proteases, but minimal activity against the proteasome It is important to ascertain the ... that are normally nonadherent to glass or plastic, by first coating the cover slips with concanavalin A or poly-L-lysine Important information may also be obtained by examining cells, using a...

Ngày tải lên: 10/04/2014, 22:14

262 263 0
animal cell electroporation and electrofusion protocols

animal cell electroporation and electrofusion protocols

... critical pore appearance in which a Boltzmann factor containing AWJkT and an order of magnitude estimate for the prefactor was used The resulting estimate for the rate of critical pore appearance ... Here U is the transmembrane voltage spatially averaged over the membrane A basic feature is already apparent in the above equation: as U increases, the pore energy, AWP, decreases, and it becomes ... Exponential Wave Form Generators The voltage of a capacitor C (capacity measured in Farad or, more conveniently, in microfarad) discharging into a resistor R (a) follows an exponential decay law (Fig...

Ngày tải lên: 11/04/2014, 09:32

358 339 0
gene isolation and mapping protocols

gene isolation and mapping protocols

... which may be more appropriate if parental data are missing, and sib-pair mapping There are also routines suitable for the analysis of quantitatrve data There are full details of these routines, and ... described above set allfile = theta; ! write results tofiles theta.out, thetaJog and theta.ps read( ldata red.dat ); ! read the linkage-format data file containing all the details of the loci used read ... gene in the human genome ? Linkage Analysis Is there a linkage with DNA markers under a specific genetic model ? A Parametric Approach Is there an increased allele sharing for affected relatives...

Ngày tải lên: 11/04/2014, 09:42

314 330 0
gene transfer and expression protocols

gene transfer and expression protocols

... pulses that then decay exponentially A range of capacitance settings can be selected, as can the applied voltage; the machine will then indicate the actual time of the discharge Both high-voltage ... Comments Normal fetal strain Normal fetal strain Normal nonfetal strain Normal adult strain Normal adult strain Normal nonfetal strain SV40-transformed XP2OS; xeroderma pigmentosum group A, W sensitive ... process as in steps 1O-21 10 Aubin, Weinfeld, and Paterson 3.2 Large-Scale Isolation of Plasmid DNA by Alkaline L&J Revive a stock of plasmid-bearing bacteria in mL of LB broth containing the antibiotic(s)...

Ngày tải lên: 11/04/2014, 09:42

416 391 0
hemostasis and thrombosis protocols

hemostasis and thrombosis protocols

... Plasmin generated is capable of cleaving sct-PA into a two-chain tPA Two-chain t-PA has more exposed binding sites and a significantly increased activity through increased binding of fibrin and ... plasminogen to plasmin by a cleaving at Arg560– Val561 Inhibition of the active enzyme occurs via PAI-1, PAI-2, and also by protease nexin Although urokinase can activate plasminogen in plasma ... downstream activation of the coagulation cascade 5.10 Factor XIII This is a tetramer of two a and b chains The b chains function as the carrier for the a chains On activation by thrombin, factor...

Ngày tải lên: 11/04/2014, 09:45

330 249 0
hepatitis b and d protocols volume 1

hepatitis b and d protocols volume 1

... CCTCAAGGTCGGTCGTTGAC CAGTCTTTGAAGTATGCCTCAAGGTCGGTC AATTTATGCCTACAGCCTCC ACCAGCACCATGCAACTTTT (T)15 GCTGG GTGCCTTGGGTGGCTTTAGGGCATGGACAT (T)15 AGCTC (T)15 GAAGC AGAGAGTAACTCCACAGAAG a Oligonucleotides in relation ... 1683 a 1752 + 1806 a 1808 a 1824 − TCTCATCTGCCGGACCGTGT GGACCGTGTGCACTTCGCTT GCACTTCGCTTCACCTCTGC TCACCTCTGCACGTCGCATG TCCATGCGACGTGCAGAGGTGAAGC GACCGACCTTGAGGCATACTTCAAAGACTG CCTCAAGGTCGGTCGTTGAC ... Hybrid Capture assay Different assays also have different linear ranges of accuracy The introduction of the WHO HBV DNA standard will facilitate standardized quantification In the future, a panel...

Ngày tải lên: 11/04/2014, 09:45

333 406 0
hepatitis b and d protocols volume 2

hepatitis b and d protocols volume 2

... from the top using the same pipet and In Vitro PBMC Proliferation Assay 33 rinse the EDTA-containing vacutainer tubes to obtain all the blood Add the NaCl back to the conical tube and mix the ... 5'-AGAAAAGACACCATGAGCACAGAAAA-3', antisense primer 5'-ACCCATTCCCTTCACAGAGCAATGA-3' (accession number Y14137) IL4: Sense primer 5'-AGAGCTATTGATGGGTCTCA-3', antisense primer 5'-TCTTTAGG CTTTCCAGGAAGTC-3' ... and the NaCl together gently by pipetting up and down Finish the samples for all animals before going to step Critical parameter: Flaming the opening of the EDTA-containing vacutainer tubes and...

Ngày tải lên: 11/04/2014, 09:45

549 454 0
in vitro transcription and translation protocols

in vitro transcription and translation protocols

... 5’ GAGAGAGAGAGAACTAGTCTCGAG~ 3’ EcoRk 5’ GAGAGAGAGAGAACI’ACTGAA 3’ For each, A, &mL = 140 ug = 11 nmol Subtraction Hybridization 17 15 X/roe&t adapter oligonucleotides: 5’ TCGAGGCGGCCGC3’ A& nL ... appreciably degrade the labeled probe The products of RNase protection reactions can be run on any DNA sequencing gel apparatus The sequencing apparatus made by Pharmacia (Macrophor), which has a thermostated ... contaminating ribonuclease Commercially available yeast RNA from Boehringer can be used after extraction with phenol-chloroform If you are in any doubt about the statusof the carrier RNA, incubate...

Ngày tải lên: 11/04/2014, 09:47

422 269 0
w