in vitro transcription and translation protocols

Transcription In Vitro 7 Incorporated cpm/pL of original reaction = average cpm per filter This value will also be used in estimating the probe specific activity in step 6.. This limit i

CHAPTER 1

EZaine l! Schenborn

1 Introduction Synthesis of specific RNA sequences in vitro is simplified because

of the availability of bacteriophage RNA polymerases and specially designed DNA vectors RNA polymerases encoded by SP6, T’7, or T3 bacteriophage genomes recognize particular phage promoter sequences

of their respective viral genes with a high degree of specificity (I-3) These RNA polymerases also transcribe DNA templates containing their cognate promoters under defined conditions in vitro (4,5) Standard reac- tion conditions for transcription in vitro can be adjusted for synthesis of large amounts of RNA or for smaller amounts of labeled RNA probes Larger-scale in vitro synthesis produces RNA that mimics biologically active RNA in many applications The following examples represent some of the different uses for RNA synthesized in vitro RNA transcripts are particularly well suited for the study of RNA virus gene regulation, For example, the in vitro transcribed RNA genomes of poliovirus (6) and cowpea mosaic virus (7) produce infectious particles in transfected cells For other types of studies, messenger RNA-like transcripts are used as substrates to study RNA processing activities, such as splicing (8) and 3’-end maturation (9,lO) RNA transcripts synthesized in vitro also are widely used as templates for protein synthesis in cell-free extracts designed for in vitro translation (II) Transfer RNA-like transcripts have been used as substrates to study RNase P cleavage specificities (12), and other mechanisms of RNA cleavage have been investigated using RNA

From: Methods in Molecular Bology, Vol 37: In Vitro Transcript/on and Translation Protocols Edlted by: M J Tymms Copynght Q 1995 Humana Press Inc , Totowa, NJ

2 Schenborn

substrates and ribozymes synthesized in vitro (13) Gene regulation stud- ies using antisense RNA also have taken advantage of the ease of in vitro RNA synthesis In vitro translation of a targeted message has been shown

to be inhibited in the presence of antisense RNA in vitro (14), and in vivo translation has been blocked in Xenopus oocytes by antisense RNA (15) The ability to synthesize discrete RNA templates in vitro also facilitates studies of RNA and protein interactions (16,17)

The generation of radioactively labeled RNA hybridization probes is a widely used application for RNA synthesized in vitro RNA probes are synthesized predominantly by incorporation of a radiolabeled ribonucle- otide, 32P-, 3H-, or 35S-rNTP, into the transcript Nonisotopic probes can

be synthesized by incorporation of biotinylated (18) or digoxigenin (19) modified bases For Northern blots, single-stranded RNA probes are gen- erally more sensitive than the corresponding DNA probe because of the higher thermal stability of RNA:RNA hybrids compared to RNA:DNA hybrids and the absence of self-complementary sequences in the probe preparation (4)

RNA probes also are more sensitive than DNA probes for the detec- tion of DNA sequences transferred to membranes from Southern blots, plaque lifts, and colony lifts (20) The lower background and increased signal sensitivity of RNA probes are possible because of higher stability

of RNA:DNA hybrids compared to DNA:DNA hybrids This increased stability allows more stringent conditions to be used for the hybridiza- tion and washing procedures (21) Another advantage of RNA probes is that RNase A can be added after the hybridization reaction to eliminate nonspecific binding of the probe to the membrane High sensitivity also has been achieved with RNA probes used for in situ hybridization (22) and localization of genes in chromosome spreads (23) RNase mapping

is another application that takes advantage of the superior properties of RNA probes for hybridization to complementary sequences In this appli- cation, a radiolabeled RNA probe is hybridized in solution to cellular RNA, then the nonhybridized, single-stranded regions of the probe are later digested with RNase A and RNase Tl, and the protected, hybrid- ized regions are identified by gel analysis This type of mapping is used

to quantitate low-abundance species of RNA, and to map exons, tran- scription start sites, and point mutations ($24)

The DNA templates used for in vitro transcription contain the cloned sequence of interest immediately “downstream” of an SP6, T7, or T3

Fig 1 Synthesis of RNA by transcription in vitro from a linear DNA template

promoter sequence Plasmid vectors are commercially available with the phage promoter sequence adjacent to a cloning region One example is the pGEM@ series of vectors (Promega, Madison, WI) designed with multiple cloning sites flanked by opposed SP6 and T7 promoters, allow- ing the synthesis of either sense or antisense RNA from a single recom- binant plasmid Discrete RNAs, corresponding to the cloned sequence of interest, are synthesized as “run-off” transcripts from a linear DNA tem- plate To prepare the linear template, the recombinant plasmid DNA is cut with a restriction enzyme cleaving within, or shortly downstream of, the cloned insert The linear DNA is then added to the reaction mixture for in vitro synthesis of RNA (see Fig 1)

2 Materials

1 Transcription buffer (5X): 200 mM Tris-HCl, pH 7.5, 30 mM MgC&

10 mM spermidine, and 50 mM NaCl Store at -2OOC

4 Schenborn

2 ATP, GT’P, CTP, UTP: 10 mM stocks prepared in sterile, nuclease-free water and adjusted to pH 7.0 Store at -20°C

3 100 mM DlT: Store at -20°C

4 RNasin@ Ribonuclease Inhibitor: (Promega) Store at -20°C

5 Nuclease-free water: Prepare by adding 0.1% diethyl pyrocarbonate (DEPC) to the water Autoclave to remove the DEPC Caution: DEPC is a suspected carcinogen

6 TE buffer: 10 mM Tris-HCl, pH 8.0, and 1 mM EDTA Prepare with stock solutions that are nuclease-free

7 TE-saturated phenol/chloroform: Mix equal parts of TE buffer and phenol, and allow phases to separate Mix 1 part of the lower, phenol phase with 1 part of chloroform:isoamyl alcohol (24: 1)

8 Chlorofornuisoamyl alcohol (24:l): Mix 24 parts of chloroform with 1 part isoamyl alcohol

9 Ammonium acetate: 7.5 and 2SM

10 3M sodium acetate, pH 5.2

11 Ethanol: Absolute (100%) and 70%

12 Enzymes: SP6, T3, or T7 RNA polymerase at 15-20 U&L

13 RNase-free DNase: RQl (Promega)

14 Restriction enzyme and appropriate buffer to linearize plasmid DNA template

15 DE-81 filters: 2.4 cm diameter (Whatman)

16 0.5M Na2HP04, pH 7.0

17 m’G(S’)ppp(S’)G: 5 r&f (New England BioLabs)

Microcentrifuge tubes, pipet tips, glassware: To provide a nuclease- free environment, use sterile, disposable microcentrifuge tubes and pipet tips whenever possible for the preparation and storage of reagents Larger

volumes of reagents can be stored in bottles that have been baked at

250°C for four or more hours to inactivate RNases

Three steps are required for synthesis of RNA in vitro:

1 Preparation of the DNA template

2 Transcription reaction

3 Enrichment of the RNA product

Transcription In Vitro 5

3.1 Preparation of the DNA Template

The sequence of interest is cloned by established methods into an appropriate vector, downstream of a promoter sequence for SP6, T7, or T3 RNA polymerase The recombinant plasmid DNA is purified, and either added directly to the in vitro transcription reaction or linearized prior to the run-off transcription reaction Transcription of supercoiled plasmid DNA results in the synthesis of high-mol-wt RNA, which contains vector sequences Discrete RNA sequences of interest, without vector sequence, are generated by run-off transcription from linear templates prepared in the following manner:

1 Determine the restriction site downstream of, or within, the cloned insert, which will generate the desired run-off transcrtpt Whenever possible, select a restriction enzyme that produces 5’ overhanging or blunt ends If

an enzyme that generates a 3’ overhang is selected, see Note 1 Set up the restriction digest according to the enzyme supplier’s directions

2 Check for completeness of digestion by agarose gel electrophorests Dur- ing this analysis, keep the DNA sample on ice If digestion is complete, proceed with step 3 Otherwise, add additional restriction enzyme to the DNA, incubate an additional 30 min, and repeat the agarose gel analysis

3 Extract the DNA by adding an equal volume of TE-saturated phenol/chlo- roform, vortex for 1 min, and centrifuge at 12,000g for 2 min Transfer the upper phase to a fresh tube, and add 1 vol of chloroform:isoamyl alcohol (24:l) Vortex for 1 min, and centrifuge at 12,000g for 2 min

4 Precipitate the DNA by transferring the upper, aqueous phase to a fresh tube, and adding 0.1 vol of 3M sodium acetate, pH 5.2, and 2 vol of abso- lute ethanol Cool 30 min at -7O”C, and centrifuge at 12,000g for 5 min

5 Carefully pour off the supernatant, wash the pellet briefly with 1 mL of 70% ethanol, spin at 12,000g for 2 min, and remove the supernatant Dry briefly in a vacuum desiccator Resuspend the pellet in nuclease-free water

or TE buffer to a final DNA concentration of approx 1 mg/mL

3.2 Synthesis of Radiolabeled RNA Probes

(See Notes 2-5)

RNA probes at a specific activity of 6-9 x lo8 cprn&g can be gener- ated by transcribing DNA in the presence of a limiting concentration (12-24 ClM) of one radiolabeled ribonucleotide and saturating concen- trations (0.5 n&f) of the other three rNTPs (see Notes 2 and 3) The following example uses 50 l.tCi of a-[32P]CTP at a specific activity of

400 Ci/mrnol/20 PL reaction, providing a final concentration of 6 l,tM of

6 Schenborn

w[~~P]CTP An additional 12 w of unlabeled CTP is added to bring the total concentration to 18 pM CTP Expect approx 1 mol of RNA/m01 of DNA template to be synthesized under these conditions

1 To a sterile microcentrifuge tube, add the following components at room temperature in the order listed This order of addition prevents precipita- tion of the DNA by spermidine: 4 pL of 5X transcription buffer, 2 p.L of

100 mit4 D’IT, 20 U RNasin* Ribonuclease Inhibitor, 4 pL of ATP, GTP, and UTP (2.5 mM each; prepare by mixing 1 vol of each individual 10 mM stock of ATP, GTP, and UTP, and 1 vol of water), 2.4 p.L of 100 p.M CTP (dilute 10 mM stock 1:lOO with water), 1 uL of DNA template (up to 2 pg; l-2 mg/mL in nuclease-free water or TE), 5 l4.L of a-[32P]CTP (400 Ci/mmol; 10 mCi/mL) Bring to a final vol of 19 uL with nuclease- free water

2 Initiate the reaction by adding 1 p.L of SP6, T7, or T3 RNA polymerase (at 15-20 U/p.L)

3 Incubate for 60 min at 37-4O”C

4 Remove 1 p.L from the reaction at this point to determine the percent incor- poration and specific activity of the probe The remainder of the sample can be digested by RQl RNase-free DNase (Section 3.6.)

3.3 Determination of Percent Incorporation

and Probe Specific Activity

1 Remove 1 uL of the labeled probe, and dilute into 19 uL of nuclease-free water Spot 3 pL of this 1:20 dilution onto 4 DE8 1 filters Dry the filters at room temperature or under a heat lamp

2 Place two filters directly into separate scintillation vials, add scintillation fluid, and count Calculate the average cpm per filter, and determine the total cpm per microliter of original reaction as follows:

Total cpm@L of original reaction = average cpm per filter

3 Wash the unincorporated nucleotides from the remaining two filters by placing the filters in a small beaker containing 50-100 mL of 0.5M Na2HP04 (pH 7.0) Swirl the filters occasionally for 5 min, then decant, and replace with fresh buffer Repeat the wash procedure two more times Dip the filters briefly into 70% ethanol, and dry at room temperature or under a heat lamp

4 Place each filter into a scintillation vial, add scintillation fluid, and count Calculate the amount of labeled nucleotide incorporated into RNA (incor- porated cpm) per microliter of original reaction as follows:

Transcription In Vitro 7

Incorporated cpm/pL of original reaction = average cpm per filter

This value will also be used in estimating the probe specific activity in step 6

5 Calculate the percent incorporation from the values determined above in steps 2 and 4

% Incorporation = (incorporated cpmkotal cpm) x 100 (3) The percentage of incorporation under the conditions described generally ranges from 70 to nearly 100% A low incorporation of radiolabeled nucle- otide (for example, below 50%) reflects a low yield of RNA product (see Note 5)

6 Calculate the specific activity of the probe as cpm/ug RNA synthesized

To do this, first calculate the total incorporated cpm in the reaction: Total incorporated cpm = (incorporated cpmQ.tL of reaction)

SA = total incorporated cprn/ug RNA (5)

In this example, the total incorporated CPM would be divided by 0.380

Pg RNA

3.4 Synthesis of Large Quantities of RNA

(See Notes 2-6) Using the following reaction conditions in which all four rNTPs are at

a saturating concentration, yields of 5-10 pg of RNA&g of DNA tem-

8 Schenborn

plate can be obtained (see Note 6) This represents up to 20 mol of RNA/ mol of DNA template Incubation with additional polymerase after the initial 60-min reaction can increase the yield of RNA up to twofold The following reaction can be scaled up or down as desired

1 To a sterile microcentnfuge tube, add the following components at room temperature in the order listed This order of addition prevents precipita- tion of the DNA by spermidine: 20 pL of 5X transcription buffer, 10 l.rL of

100 mM DTT, 100 U RNasin Ribonuclease Inhibitor, 20 pL of ATP, GTP, UTP, and CTP (2.5 rnM each; prepare by mixing 1 vol of each individual

10 mM stock of ATP, GTP, UTP, and CTP), 2-5 pL of DNA template (5-

10 pg total; l-2 mg/rnL in nuclease-free water or TEZ) Add nuclease-free water to a final vol of 98 pL

2 Initiate the reaction by adding 2 lrL of SP6, T7, or T3 RNA polymerase (at 15-20 U&L)

3 Incubate for 60 min at 37aO°C

4 Add an additional 2 pL of SP6, T7, or T3 RNA polymerase Incubate for

60 min at 37-4O”C

The DNA template can now be digested by RQl RNase-free DNase (Section 3.6.)

3.6 Synthesis of 5’ Capped Transcripts

Some RNA transcripts require a m7G(5’)ppp(5’)G cap at the 5’ end for higher translation efficiency, either in cell-free extracts or in Xenopus

oocytes (25) Methylated capped transcripts also have been reported to function more efficiently for in vitro splicing reactions (8) and are more

resistant to ribonucleases in nuclear extracts The following reaction can

be scaled up or down as desired

1 To a sterile microcentrifuge tube, add the following components at room temperature m the order listed This order of addition prevents precipita- tion of the DNA by spermidine: 4 pL of 5X transcription buffer, 2 PL of

100 rnM DTT’, 20 U RNasin Rtbonuclease Inhibitor, 4 pL of ATP, UTP, and CTP (2.5 rnM each; prepare by mixing 1 vol of each individual

10 mM stock of ATP, UTP, and CTP, and 1 vol of water), 2 PL of GTP (0.5 mM, dilute 10 rnM stock 1:20 with water), 2 p.L of the cap analog m7G(5’)ppp(5’)G (5 mM), and 1 pL of DNA template: l-2 pg (l-2 mg/mL

in nuclease-free water or TE) Add nuclease-free water, if necessary, to a final vol of 19 j.rL

2 Initiate the reaction by adding 1 pL of SP6, T7, or T3 RNA polymerase (at 15-20 U&L)

3 Incubate for 60 min at 37AOOC

Transcription In Vitro 9

The DNA template can now be digested by RQl RNase-free DNase (Section 3.6)

3.6 Digestion of the DNA Template Posttranscription

To achieve maximal sensitivities with RNA probes, the DNA tem- plate must be eliminated after the transcription reaction Elimination of the DNA template also may be required for the preparation of biolog- ically active RNAs DNase can be used to digest the DNA template, but during this enzymatic step, it is critical to maintain the integrity of the RNA RQ 1 DNase (Promega) is certified to be RNase-free and is recom- mended for the following protocol

1 After the in vitro transcription reaction, add RQl RNase-free DNase to a concentration of 1 U&g of template DNA

2 Incubate for 15 min at 37OC

3 Extract with 1 vol of TE-saturated phenol/chloroform Vortex for 1 min, and centrifuge at 12,000g for 2 min

4 Transfer the upper, aqueous phase to a fresh tube Add 1 vol of chloro- fornuisoamyl alcohol (24:l) Vortex for 1 min and centrifuge as in step 3

5 Transfer the upper, aqueous phase to a fresh tube At this point, a small aliquot can be taken for electrophoretic analysis on a denaturing gel, and the remainder of the sample can be precipitated (Section 3.7.)

3.7 Precipitation of RNA

1 Add 0.5 vol of 7.94 ammonium acetate to the aqueous RNA sample pre- pared in Section 3.6 If the RNA sample was not digested with RQl DNase, extract the RNA after the transcription reaction with TE-saturated phenol/ chloroform followed by a chloroform extraction, as described in Section 3.6., steps 3-5

2 Add 2.5 vol of ethanol, mix, and place at -70°C for 30 min

3 Centrifuge at 12,000g for 5 min Carefully remove the supernatant

4 Resuspend the RNA pellet in 100 pL of 2.5M ammonium acetate and mix

5 Repeat the ethanol precipitation as described in steps 2 and 3 above

6 Dry the pellet briefly under vacuum, and resuspend in 20 pL or other suit- able volume of sterile TE or nuclease-free water Store the RNA at -70°C

4 Notes

1 Extraneous transcripts complementary to the opposite strand and vector sequences are generated from DNA templates with 3’ overhanging ends (26) The ends of these templates can be made blunt in the following man- ner using the 3’-5’ exonuclease activity of the Klenow fragment of DNA polymerase I Set up the transcription reaction, but without nucleotides

10 Schenborn

Table 1

SA and Concentration of rNTPs Used for Transcription In Vitro

Nucleotide Specific activity @Meaction Final cont

CX-[~%] rNTP 1300 Ci/mmoi 300 PCi 12cLM 5,6[3H] rNTP 40 Wmmol 25 pCi 31 w

and RNA polymerase Add 5 U of Klenow fragment&g DNA, and incu- bate for 15 min at 22OC Then initiate the transcription reaction by adding nucleotides and RNA polymerase, and incubate for 60 min at 3740°C

2 Incomplete transcripts are more likely to be generated under the condi- tions used for probe synthesis, in which the concentration of a radiolabeled nucleotide becomes limiting Of the four nucleotides, rGTP yields the high- est percentage of full-length transcripts when present in limiting concen- trations (4) However, for best results, radiolabeled rGTP should be used

within 1 wk of the reference date rATP yields the lowest percentage of full-length transcripts and lowest incorporation when present at a limiting concentration (5) In some cases, the amount of full-length transcripts increases when the incubation temperature is lowered to 30°C Another possible cause for incomplete transcripts can be the presence of a sequence within the DNA template that acts as a terminator for that particular poly- merase In this case, one can subclone the sequence of interest behind a different RNA polymerase promoter

3 The specific activity of a probe can be increased by using more than one radiolabeled nucleotide per reaction at a limiting concentration Also, more than 5 p,L of the radionucleotide can be used per 20 p.L reaction if the nucleotide is first aliquoted into the reaction tube and dried down under vacuum Table 1 lists the final concentration (final cont.) of radionucleotides commonly used in RNA probe synthesis, in a 20-pL reaction volume Thiol-substituted rNTPs are incorporated less efficiently by the RNA poly- merases than the corresponding 32P or 3H rNTPs (5)

4 Biotinylated rNTP can be added during the transcription reaction, but the yield of RNA may be lowered Alternatively, RNA can be modified after transcription using photoactivatable biotin (27)

5 A low yield of RNA product can be caused by several conditions, includ- ing precipitation of DNA by spermidine in the transcription buffer, RNase contamination, carryover of residual contaminants or salts in the DNA preparation, or inactive RNA polymerase

6 High yields of RNA synthesized by SP6 or ‘IT RNA polymerase recently have been reported using a transcription buffer containing 80 mM HEPES-

Transcription In Vitro 11

KOH, pH 7.5,2 mM spermidine, 1040 mM DlT, 3 mM each rNTP, 12-

16 mA4 MgCl,, and 1200-1800 U/mL RNA polymerase Under these con- ditions, yields up to 80 p.g of RNA/pg DNA were reported (28)

3 Jorgensen, E D., Joho, K., Risman, S., Moorefield, M B., and McAllister, W T (1989) Promoter recognition by bacterophage T3 and T7 RNA polymerases, in DNA- Protein Interaction in Transcription (Gralla, J D., ed.), Liss, New York, pp 79-88

4 Melton, D A., Krieg, P A., Rebagliati, M R., Maniatis, T., Zinn, K., and Green,

M R (1984) Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter Nucleic Acids Res 12,7035-7056

5 Krieg, P A and Melton, D A (1987) In vitro RNA synthesis with SP6 RNA polymerase Methods Enzymal 155,397-4 15

6 Kaplan, G., Lubinski, J., Dasgupta, A., and Racaniello, V R (1985) In vitro syn- thesis of infectious poliovirus RNA Proc Natl Acad, Sci USA 82,8424-8248

7 Eggen, R., Verver, J., Wellink, J., DeJong, A., Goldbach, R., and van Kammen, A (1989) Improvements of the infectivity of in vitro transcripts from cloned cowpea mosaic virus cDNA: impact of terminal nucleotide sequences Virology 173, 447-455

8 Kramer, A R., Maniatis, T., Ruskin, B., and Green, M R (1984) Normal and mutant human /3-globin pre-mRNAs are faithfully and efficiently spliced in vitro Cell 36,993-1005

9 Krieg, P A and Melton, D A (1984) Formation of the 3’ end of histone mRNA by post-transcriptional processing Nature 308,203-206

10 Georgiev, O., MOUS, J., and Birnstiel, M (1984) Processing and nucleo-cytoplas- mic transport of histone gene transcripts Nucleic Acids Res 12,8539-8551

11 Krieg, P A and Melton, D A (1984) Functional messenger RNAs are produced

by SP6 in vitro transcription of cloned cDNAs Nucleic Acids Res 12,7057-7070

12 Burgin, A B and Pace, N R (1990) Mapping the active site of ribonuclease P RNA using a substrate containing a photoaffinity agent EMBO J 9,4111-4118

13 Heus, H A., Uhlenbeck, 0 C., and Pardi, A (1990) Sequence-dependent struc- tural variations of hammerhead RNA enzymes Nucleic Acids Res 18,1103-l 108

14 Nicole, L M and Tanguay, R M (1987) On the specificity of antisense RNA to arrest in vitro translation of mRNA coding for Drosophila hsp 23 Biosci Rep 7, 239-246

15 Melton, D A (1985) Injected antisense RNAs specifically block messenger RNA translation in vivo Proc Natl Acad Sci USA 82, 144-148

16 Witherell, G W., Wu, H.-N., and Uhlenbeck, 0 C (1990) Cooperative binding of R17 coat protein to RNA Biochemistry 29, 11,05 l-l 1,057

12 Schenborn

17 Turek, C and Gold, L (1990) Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase Science 249, 505-5 10

18 Langer, P R., Waldrop, A A., and Ward, D C (1982) Enzymatic synthesis of biotin-labeled polynucleotides: novel nucleic acid affinity probes Proc Natl Acad Sci USA 70,6633-6637

19 Aigner, S and Pette, D (1990) In situ hybridization of slow myosm heavy chain mRNA in normal and transforming rabbit muscles with the use of a nonradioac- tively labeled cRNA Histochemistry 95,1 l-l 8

20 Sambrook, J., Fritsch, E F., and Maniatis, T (1989) Molecular Cloning, A Lube- ratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

21 Casey, J and Davidson, N (1977) Rates of formation and thermal stabilities of RNA:DNA and DNA:DNA duplexes at high concentrations of formamide Nuclezc Acids Res 4, 1539-1552

22 Uhlig, H., Saeger, W., Fehr, S., and Ludecke, D K (1991) Detection of growth hormone, prolactin and human beta-chorionic gonadotropm messenger RNA in growth-hormone-secreting pituitary adenomas by in situ hybridization Virchows Arch Pathol Anat Histopathol 418,539-546

23 Matthaei, K I and Reed, K C (1986) Chromosome assignment m somatic hybrids

by in situ hybridization with tritium labeled Riboprobe@ RNA probes Promega Notes 5,5-6

24 Zinn, K., DiMaio, D., and Maniatis, T (1983) Identification of two distinct regula- tory regions adjacent to the human p-interferon gene Cell 34,865-879

25 Contreras, R., Cheroutre, H., Degrave, W., and Fiers, W (1982) Simple, efficient

in vitro synthesis of capped RNA useful for direct expression of cloned eukaryotic genes Nucleic Acids Res 10,6353-6362

26 Schenborn, E T and Mierendorf, R C (1985) A novel transcription property of SP6 and T7 RNA polymerases: dependence on template structure Nucleic Acids Res 13,6223-6236

27 Forster, A C., Mclnnes, J L., Skingle, D C., and Symons, R H (1985) Non- radioactive hybridization probes prepared by the chemical labelling of DNA and RNA with a novel reagent, photobiotin Nucleic Acids Res 13,745-761

28 Gurevich, V V., Pokrovskaya, I D., Obukhova, T A., and Zozulya, S A (1991) Preparative in vitro mRNA synthesis using SP6 and T7 RNA polymerases Analyt Biochem 195,207-2 13

CHAPTER 2

cDNA Libraries

Clifford W Schweinfest, Peter S Nelson,

Michael W Graber, Rita I Demopoulos,

and Takis S Papas

1 Introduction Subtraction-hybridization cDNA libraries (14) are libraries enriched for sequences representing mRNAs whose expression in one biological source (e.g., tissues, cell lines) is different than in a second source Single-stranded cDNAs from both sources are allowed to hybridize so that sequences common to the two sources will anneal The annealed, double-stranded DNAs are “subtracted” from the hybridization solution, leaving a population of cDNA molecules enriched for sequences pref- erentially expressed (or repressed) in the biological source of interest Figure 1 diagrammatically represents the scheme for subtraction hybrid- ization currently employed in our laboratory

The subtraction technique is particularly helpful for isolating differen- tially expressed genes for which there is no apriuri knowledge (e.g., loss

of heterozygosity) Therefore, the subtraction technique may ask the question, “What gene expression is different between two selected cell types, such as tumor vs normal?” As such, it is important that such matched sets of tumor and normal tissue be as similar as possible For example, a colon tumor is typically a benign or cancerous outgrowth of epithelial cells of the mucosal layer Its matched normal should be nor- mal mucosa from the same patient Further, where possible, the tumor sample should be as homogenous as possible (7040% is usually suffi-

From: Methods m Molecular Biology, Vol 37: In V&o Transcnption and Translation Protocols

Edited by: M J Tymms CopyrIght 0 1995 Humana Press Inc., Totowa, NJ

13

S.S cDNAT

or streptavldin +

+

+

Subtraction Hybridization 15

cient) Nonetheless, in spite of these precautions, tissues from organisms will undoubtedly contain other cell types not necessarily desired (undif- ferentiated fibroblasts, blood cells, and so on) A more controlled sub- traction can be achieved when working with cell lines Here, a subtraction

is typically performed on identical cell types, except that one may be cultured under different growth conditions (e.g., high serum, growth fac- tor addition) or in the presence of an inducing agent for differentiation or after transfection with a cloned gene

Prior to the subtraction-hybridization technique, differential hybridization was used to identify differentially expressed cDNAs (5~5) The limit of sen- sitivity of this method was that of cDNA (mRNA) species of approx 0.1% abundance This limit is imposed partly by the absolute amount of a specific differentially expressed sequence in a total cDNA probe population and partly by the kinetics of the pseudo-first-order hybridization with these cDNA probes to total cDNA libraries In our hands, subtraction hybridization provides a sensitivity sufficient to isolate mRNAs with a 0.01% abundance For most subtractions, it is advantageous to start with two cDNA libraries whose inserts are unidirectional and in opposite orientation to each other (see Fig 1) In this way, the induced single-strand phage DNA will contain vectors of the same polarity (hence, nonhybridizing) and inserts of opposite polarity Therefore, only interlibrary hybridization events will occur Also, two libraries make it possible to perform subtractions in both directions, which, in turn, allows both induced and repressed cDNAs to be enriched and isolated Nondirectional libraries will also undergo intralibrary hybrid- ization events that are not helpful for enrichment of differentially expres- sed clones On the other hand, an advantage of nondirectional libraries is that they can be randomly primed (as opposed to oligo dT primed) so as

to maximize sequence representation within the library This can be help- ful in representing 5’ ends that may not otherwise be reverse transcribed because of mRNA length or secondary structure As a general rule, how- ever, we prefer to use directional cDNA libraries since hybridization and subtraction of such libraries maximize enrichment The protocol that fol- lows is for subtraction with unidirectional libraries

2 Materials 2.1 RNA Preparation

1 Guanidine isothiocyanate (GTC, Gibco-BRL, Gaithersburg, MD)

2 CsCl (Gibco-BRL)

16 Schweinfest et al

3 Lysis solution: 4M GTC, 100 n&f Tris-HCl, pH 7.5, and 0.5% sodium sarkosyl This GTC solution is made up in RNase-free Hz0 (HZ0 treated for 30 min with 0.1% diethylpyrocarbonate and then autoclaved) then fil- tered through a 0.4Qtm filter, and stored at 4OC Just before use, p-mercap- toethanol may be added to a concentration of O.lM in the aliquot to be used

4 CsCl solution: 5.7M CsCl and 0 1M EDTA, pH 7.0, are prepared in RNase- free H,O, and then autoclaved

5 Mortar and pestle (baked to be RNase-free)

6 Dounce homogenizer (baked)

7 3M sodium acetate, pH 5.5 (made RNase-free)

8 TE: 10 mM Tris-HCl, pH 7.5, and 1 mM EDTA (RNase-free)

9 mRNA purification kit (Pharmacia, Piscataway, NJ)

10 Methyl mercury hydroxide (Alfa, Danvers, MA) Caution: extremely toxic

2.2 cDNA Synthesis and Subtraction

1 Reverse transcriptase (Gibco-BRL)

2 RNaseH (Gibco-BRL)

3 E coli DNA polymerase I (Boehringer Mannheim, Indianapolis, IN)

4 T4 DNA ligase (Boehringer Mannheim)

5 Polynucleotide kinase (Boehringer Mannheim)

6 Klenow fragment (Boehringer Mannheim)

7 T4 DNA polymerase (New England Biolabs, Beverly, MA)

8 E cob DNA ligase (New England Biolabs)

9 RNasin @omega, Madison, WI)

10 dNTPs: All four deoxynucleotide triphosphates, as well as 5-methyl deoxy- cytidine triphosphate (m5dCTP) and adenosine triphosphate (Pharmacia), are in solution where possible The m5dCTP is made up as a lOO-mM solu- tion in RNase-free 10 mM Tris, pH 7.5

11 20X first-strand nucleotides: 10 n&f dATP, 10 mM dGTP, 10 mM dTTP, and 5 mM mSdCTP

12 50X second-strand RX nucleotides: 7.5 mM dATP, 7.5 mM dGTP, 7.5 mA4 dTTP, and 35 mM dCTP

13 50X second-strand XR nucleotides: 7.5 n&f dATP, 7.5 mM dGTP, 7.5

mM dTTP, and 10 mM m5dCTP

14 Linker-primers: synthesized on an Applied Biosystems (Foster City, CA) 381A DNA synthesizer and purified on an oligonucleotide purification cartridge

XhoI: 5’ GAGAGAGAGAGAACTAGTCTCGAG~ 3’

For each, 5 A,&mL = 140 ug = 11 nmol

Subtraction Hybridization 17

15 X/roe&t adapter oligonucleotides:

5’ TCGAGGCGGCCGC 3’ 5 A&nL = 38.2 nmol = 155 l,tg (“long” oligo) 3’ CCGCCGGCG 5’ 5 A&nL = 60 nmol = 167 pg (“short” oligo)

16 EcoRI.Not adapter (Pharmacia) is 5’-d[AAlTCGCGGCCGCT]-3’

21 10X annealing buffer: 200 mM Tris-HCI, pH 7.5, and 500 mM NaCl

22 10X STE: 100 mM Tris-HCl, pH 7.5,1.5M NaCl, and 10 mM EDTA

27 Kanamycin (Gibco-BRL) and ampicillin (Sigma, St Louis, MO)

28 Phage precipitation solution: 3.5M ammonium acetate, pH 7.5, and 20% polyethylene glycol (PEG8000)

29 Photoprobe Biotin and Avidin D agarose resin (Vector Laboratories, Burlingame, CA): Resin is prepared by washing the slurry three to four times in resin buffer (see step 26), removing the last wash, and working with the packed resin Photobiotin and Streptavidin from Gibco-BRL can also be used

30 GE Sunlamp Model RSK with 275-W bulb

3 1 HE buffer: 10 mM HEPES, pH 7.5, and 1 mM EDTA

32 2-Butanol (Baker, Phillipsburg, NJ)

33 2X hybridization mix: 1,5MNaC1,50 mM HEPES, pH 7.5,lO mM EDTA, and 0.2% SDS

34 Resin buffer: 1M NaCl and 20 mA4 HEPES, pH 7.5

35 2X YT media: 10 g NaCl, 10 g yeast extract, and 16 g bacto-tryptone/L

36 Superbroth media: 35 g bactotryptone, 20 g yeast extract, and 5 g NaCl,

18 Schweinfest et al

39 Sterile 50% glycerol

40 Gene Amp PCR Kit (Perkin-Elmer Cetus, Norwalk, CT): This includes a 10X buffer, nucleotides, and Taq DNA polymerase

41 Random Primers Labeling Kit (Gibco-BRL)

42 Quik Hyb hybridization solution (Stratagene)

43 20X SSPE stock: 3.6A4 NaCl, 0.2M NaH2P04, and 20 miI4 EDTA, pH 7.4

44 TE: 10 rnMTris-HCl, pH7.5, and 1 mMEDTA

3.1 mRNA Isolation

Tissues to be used for mRNA isolation should be quickly dissected of

heterogenous tissue and snap frozen in liquid nitrogen until used Frozen

tissue should be ground to a powder with a mortar and pestle, occasion-

ally adding liquid nitrogen to maintain a frozen “crunchy” state The powder is then lysed in the GTC reagent Cell-culture sources should be healthy and well fed before harvesting Avoid using confluent cultures,

if possible Cells should be harvested quickly, washed one to two times in sterile saline, and lysed immediately in the GTC reagent (see Note 1) RNA

from the GTC-lysed material is purified by centrifugation through a CsCl cushion, and the RNA recovered according to published protocols (7)

1 Grind the frozen tissue to a powder with a mortar and pestle, and then transfer the frozen powder to a Dounce homogenizer

2 Add the GTC reagent (“8 r&/g of starting tissue) As the frozen tissue/ powder thaws in the GTC reagent, dounce homogenize until the sample IS uniformly lysed

3 Layer the lysate on top of a 4-4.5 mL solution of 5.7M CsCl and O.lM EDTA, pH 7.0, in a quick-seal tube for a 50Ti Beckman rotor Fill the tube

to the top with the GTC solution, and seal the tube Centrifuge at 34,000 rpm for 15-18 h at 15OC Alternatively, a swinging bucket rotor, such as an SW41, may be used, but the centrifugation time should be increased to 20 h

6 Collect the precipitate at maximum speed for 15 min at 4°C in a microfuge, and then resuspend the ethanol precipitate in RNase-free H,O

7 mRNA should be purified by at least two rounds of binding and elution from oligo dT cellulose (We find it convenient to use the spin-column kit and method from Pharmacia, especially when multiple samples are being processed.)

8 If the source of tissue or cells is abundant, we typically process 1 mg of total RNA and expect yields of about 20 pg of mRNA When the source

is nonabundant (e.g., human tissues), a yield of 2% of the input total RNA

is assumed (not measured by absorbance) for the purpose of cDNA syn- thesis (see Note 2)

3.2 cDNA Library Construction

The synthesis is performed essentially by the method of Gubler and Hoffman (8) with some modifications from Stratagene’s Uni-Zap Kit and some of our own

1 Heat denature l-2 pg of mRNA in 2 l.tL RNase-free HZ0 at 65°C for 5 min, and then chill on ice (see Note 3)

2 Add 2 p,L of 10 mM CHsHgOH (caution: toxic), and incubate for 10 min

at room temperature

3 Add 1 pL of 75 mM P-mercaptoethanol (to sequester the mercury), and incubate for 5 min at room temperature The denatured mRNA is now

in 5 pL and is ready for cDNA synthesis

4 Prepare a Master Mix #l, which contains the following components per each first-strand cDNA synthesis to be performed: 4 l.tL of 5X Superscript buffer,

2 pL of O.lM DTT, 1 pL of RNasin, 0.4 pL of 10 mCi/mL a-[32P]dATP, 3.6 j.tL of H20, and 1 p,L of 200 U/pL Superscript

5 Combine the following reagents to perform the first-strand cDNA synthe- sis: 5 pL denatured mRNA, 1 yL of 20X first-strand nucleotides, 2 p,L of 1.4 pg/mL appropriate linker primer (XhoI or EcoRI linker primer), and 12

20 Schweinfest et al

7 Toward the end of first-strand synthesis, prepare a Master Mix #2 contain- ing the following components per each second-strand reaction to be per- formed: 10 p.L of 10X second-strand buffer, 3.75 p,L of O.lM DTT, 0.6 p,L

of 10 mCi/mL a-[32P]dATP, 1 PL of 15 mM PNAD, 0.5 pL of 10 mg/mL BSA, 5 PL of 5 U/pL E cull DNA polymerase I, 0.5 PL of 2 U/p,L RNaseH, 0.25 l.tL of 4 U@L E coli DNA ligase, and 56.4 l,tL of H20

8 Immediately after first-strand synthesis, dilute the 20 pL reaction into the Master Mix #2 along with appropriate nucleotide mixtures: 20 p,L of first- strand reaction, 2 PL of 50X appropriate nucleotides (RX nucleotides for XhoI-primed, XR nucleotides for EcoRI-primed) and 78 p,L of Master Mix #2

9 Incubate the second-strand reaction 1.5 h at 14”C, and then 30 min at room temperature

10 Add 10 U of T4 DNA polymerase, and then incubate 30 min at 37°C Heat kill the reaction at 65°C for 10 min

11 Extract once in phenol: CHC13 (1: 1)

12 Purify the samples through a Sephacryl-200 spin column: A 2-mL (bed volume) Sephacryl-200 column is prepared in an IsoLab QS-P column tube It is equilibrated in 1X STE, allowed to run dry by gravity, and then prespun for 2 min at 4OOg in a swinging bucket configuration The -100 l.tL sample is carefully applied to the top of the column resin (now a cylin- der that has somewhat shrunken back from the sides of the column) and spun for 2 min at 400g Approximately 100 p.L are recovered One to five microliters may be saved for later analysis (see Notes 4 and 5)

13 Precipitate the purified cDNA by adding l/20 vol of 3M sodium acetate,

pH 5.5, and 2.5 vol of ethanol Wash the pellet once in 80% ethanol Lyo- philize to dryness

14 Kinase 10 nmol of the “short” oligo of the XhoaNot adapter in the follow- ing 20 l.tL reaction mixture: 10 l.tL of 1 nmol&L “short” oligo, 2 l.tL of 1 OX kinase buffer, 1 pL of 100 mA4 rATP, 6 pL of H20, and 1 p.L of 10 U&L polynucleotide kinase

15 Incubate kinase reaction for 30 min at 37OC

16 Heat inactivate the polynucleotide kinase by incubating the reaction at

70°C for 30 min

17 Combine the kinased “short” ohgo with the “long” oligo in the following annealing mixture: 20 pL of kinased “short” oligo, 10 ILL of 1 nmol/p,L

“long” oligo, 10 PL of 10X annealing buffer, and 60 p,L of H20

18 Boil the annealing mixture 5 min and then allow to slowly cool to < 3O’C The XhoG’Vot adapter is now ready to ligate to the cDNA (The EcoRIJVut adapter is purchased from Pharmacia ready to use.) The annealed adapter

is now 100 pm0Vp.L

Subtraction Hybridization 21

19 Ligate the appropriate adapter to each cDNA (the XhoI-primed cDNA receives the EcoRIJVot adapter; the EcoRI-primed cDNA receives the Xho.Not adapter) by resuspending the lyophilized cDNA (step 13) in the following 10 I.~L reaction: 5 l.tL of 100 pmol&L appropriate adapter, 2 i.tL

of HzO, 1 ,FLL of 10X ligase buffer, 1 PL of 10 rnM rATP, and 1 l.tL of 2-5 U/l & T4 DNA ligase

20 Incubate the ligation reaction overnight at 4”C, and then inactivate the ligase at 68°C for 30 min

21 Kinase the adapter cDNA in the following 20 PL reaction: 10 p.L of adapter-cDNA, 1 pL of 10X kinase buffer, 2 l.tL of 10 rnM rATP, 6 p,L of HzO, and 1 p,L of 10 U/pL polynucleotide kinase

22 Incubate the reaction at 37OC for 30 min, and then inactivate the enzyme at 70°C for 30 min

23 Digest each cDNA at its 3’ end (XhoI or EC&I) with the appropriate enzyme for 1 h at 37°C in a total volume of 50-60 pL For the X/z01 digestion, use

100 U of XhoI&tg of cDNA to be digested (see Note 4 for cDNA quantitation) For the EC&I digestion, divide the cDNA into three equal ahquots, and digest

in a volume of 20 p,L using 40,80, and 160 U&g cDNA The digestions are always performed with the manufacturer’s supplied buffers (see Note 6)

24 Following EcoRI digestion, pool the three aliquots, and proceed immedi- ately to the next step

25 Adjust the digested cDNA to 100 l.rL vol and 1X STE

26 Extract once with 100 l.tL phenol:CHCls (1: l), and purify through a Sephacryl-200 spin column as in step 12 Recovery is approx 100 pL (see Note 7)

27 Count l-2 pL of the cDNA by liquid scintillation in order to determine its concentration using the specific activity determined earlier (see Note 4)

28 Coprecipitate equimolar amounts of the vector (EcoRI.XhoI digested XZAPII) and cDNA with ethanol (see Note 8) The precipitation mixture is

1 pL of 1 l.tg/pL vector DNA, an equimolar amount of cDNA (typically c20 I.~L, see Note 8), 1X STE up to a volume of 20 pL, 1 l.tL of 3M sodium acetate, and then 50 l,t.L of 100% ethanol (see Note 9)

29 Precipitate at -80°C (dry-ice powder) for 15 min, and then collect precipi- tate by centrifugation at maximum speed in a microfuge for 15 min at 4°C

30 Wash the pellet once in 80% ethanol, and air-dry briefly (do not lyophihze)

31 Resuspend the pellet in 5 l.tL of ligation mixture (0.5 l,tL of 10X ligation buffer, 0.5 l.tL of 10 mM rATP, 2 U of T4 DNA ligase, and Hz0 up to 5 JJL final ~01)

32 Ligate overnight at 12OC, and then allow 2 h at room temperature

33 Package l-2 j.tL of the ligation reaction with Stratagene’s Gigapack II Gold exactly according to the manufacturer’s protocol Titer the cDNA librar-

22 Schweinfest et al

ies, expecting at least l@-lo6 PFU/mL for the cDNAs (the EcoRI linker- primed library is usually on the low end of this range) and at least lo6 PFU/

mL for the test insert This lrbrary (primary recombinants) must be titered

on Stratagene strains PLK-F’, XLl-Blue MRF’, or SURE, which allow the growth of phage that contain methylated DNA (see Note 10)

3.3 Mass Rescue of the cDNA Libraries

Rescue is the conversion of the h library to the single-stranded phag- emid library by the process of in vivo excision During in vivo excision,

a helper phage recognizes the initiation site of the origin of replication for the pBluescript phagemid embedded, along with the cloned cDNA, within the h vector Replication proceeds, copying the pBluescript phagemid and your cloned cDNA, until the termination site of the origin

of replication is reached, where the newly synthesized single strand is circularized, packaged as a phagemid, and secreted from the E coli host

It is important to rescue the once-amplified library in a manner that minimizes possible differential growth of the individual cDNAs, while maximizing the yield of recombinant single-stranded phage It is also helpful, though not imperative, to minimize the amount of helper phage input (and subsequent output) during the rescue in order to generate as pure a yield as possible The following procedure is our current “state- of-the-art” method for achieving those goals:

1 Combine 3 x log XLl-Blue cells in 2X YT medium (10 mL of cells grown

to OD6a0 of 0.4), 3 x log recombinant hZAP phage particles from a once- amplified library, and lOi VCS Ml3 helper phage

2 Allow 15 min absorption at 37OC

3 Grow, shaking, at 37°C for 2-3 h (do not exceed this time)

4 Heat the sample at 70°C for 20 min

5 Pellet cells and debris by centrifugation at 6000g for 5-10 min

6 Decant and save the supernatant containing rescued phage and helper

7 Combine 1 mL of supernatant and 20 mL of exponentially growing XLl- Blue cells (ODsoo = 0.4) grown m superbroth

8 Grow for 02 h (until OD = l.O), and then dilute 50-fold into prewarmed superbroth After 30-60 mm growth at 37OC, add kanamycin and ampicillin to 50 pg/mL each, and grow at 37°C for 8-16 h

9 Pellet cells and debris Save supernatant

10 Clarify supernatant with a second centrifugation (at a higher speed) to pel- let any remaining material

11 Precipitate the phage from the supernatant by adding 114 vol of 3.5M ammon- ium acetate, pH 7.5, and 20% polyethylene glycol (PEG 8000)

1 Aliquot 100 l.tg ss DNA, and adjust volume up to 0.5 mL in HE

2 Sonicate twice for 60 s

3 Ethanol precipitate and resuspend in 100 p,L HE

4 Under a safe light, add 100 ILL of 1 mg/mL photoprobe biotin to the DNA

5 Mix and place the open tube, open, in ice bath at a distance of 10 cm from

a GE sunlamp (Model RSK-6) equipped with a 275-W bulb Irradiate for

15 min

6 Adjust the solution to O.lM Tris-HCl, pH 9.0

7 Extract twice with an equal volume of 2-butanol

8 Ethanol precipitate The pellet should have a reddish brown or purple color

If not, repeat the photobiotinylation

9 Resuspend the biotinylated ss DNA (b-ss DNA) in 100 l.tL HE

3.5 Subtraction Hybridization

This method is essentially that of Duguid et al (2)

1 In a total volume of 400 l.tL or less, combine a lo-fold excess of biotinylated ss DNA with nonbiotinylated ss DNA in the following mix- ture: 50-100 pg b-ss DNA, 5-10 l.tg ss DNA (this is the DNA to be enriched), 5 pg poly (A), and 5 pg poly (C)

2 Ethanol precipitate the mixture by adjusting it to 0.3M sodium acetate and adding 2-2.5 vol of ethanol Incubate at -8OOC for 15 min, then collect the precipitate at 4°C for 15 mm at maximum speed in a microfuge, and resus- pend in 10 pL HzO

3 Add 10 p,L of 2X hybridization mix

4 Seal the mixture into a sihconized 100 p.L capillary tube

5 Boil l-2 min at 100°C

6 Allow to hybridize at 68°C for 20 h

7 After hybridization, carefully shake the contents down to one end of the capillary, break it open, and recover the DNA with a drawn-out capillary

or other narrow pipeting device

8 Dilute the reaction up to 200 FL with HE buffer

24 Schweinfest et al

9 Adjust to 1M NaCl and 20 mM HEPES, pH 7.5 (Resin Buffer = RB)

10 Add 200 pL of packed Avidin D agarose resin

11 Incubate 30 min at room temperature while gently rocking or rotating the mixture

12 Microfuge 30 s at 3000g Save supernatant

13 Wash the resin three times in 200 pL RB Save each supernatant

14 Pool the supematants and combine with 100 uL fresh-packed resin Incu- bate 30 min on a rotator, as above

15 Pellet resin 30 s at 3000g Save the supematant

16 Wash the pellet three times in 100 pL RB Save the supematants

17 Dilute the mixture to 0.5M NaCl and ethanol precipitate overnight at

3.6 Conversion of Subtracted ss cDNA

into a Plasmid Library

In order to make permanent subtractive libraries, the ss cDNA is con- verted to double-stranded and transfected into E coli

3.6.1 Conversion

1 Anneal the subtracted ss cDNA to a primer (reverse primer or T3) in the following lo-pL mixture: 5 pL of subtracted ss cDNA, 1 pL of 10X anneal- ing buffer, 0.5 l.tL of 10 w primer, and 3.5 pL of H20

2 Heat to 68OC for 3-5 min, and allow to cool slowly to ~30°C

3 Proceed with synthesis of the second strand: 10 p.L of annealed DNA, 5 p.L

of 10X Klenow buffer, 0.5 pL of 5 mM 4 dNTPs, 10 U of Klenow frag- ment, and Hz0 up to a final volume of 50 pL

4 Incubate at 37OC for 2 h

3.6.2 E coli Transforming and Library Formation

1 Transform up to 5 uL into competent E coli (e.g., XLl-Blue, NM522) exactly according to the supplier’s protocol It is important to include the X-gal/FIG color selection as well

2 Pick the white colonies into 96-well microtiter plates containing 100 pL of

LB + 50 pg/mL ampicillin Grow overnight on an orbital shaker at 37°C

3 Add 100 pL sterile 50% glycerol, shake another 15 min, and then freeze at -7OOC Subtraction libraries organized in this way can be replica plated onto a 150-mm Petri dish without thawing the library

Subtraction Hybridization 25

3.7 Screening for Differentially Expressed cDNAs

Depending on the extent to which subtraction removed common

sequences and depending on the abundance of a given differentially expressed cDNA, anywhere from a few to a few hundred subtracted library clones may have to be screened The approach we favor is listed below For other approaches, see Notes 19 and 20

3.7.1 PCR Amplification of Subtracted ss cDNA

1 Utilizing a GeneAmp PCR Kit and the subtracted ss cDNA (Section 3.5., step 19), assemble the following PCR reaction: 5 PL of subtracted ss cDNA, 5 pL 10X PCR buffer, 2.5 p.L of 20 l.tJ4 T3 primer, 2.5 PL of 20

@4 Ml3 primer, 1 PL 10 mJ4 dN’I’Ps (all four), 2.5 U of Taq polymerase, and Hz0 up to 50 pL

2 Overlay with 50 pL mineral oil

3 Amplify using the following regime: 94°C for 7 min, followed by 25 cycles

of 94°C for 1 min, 41°C for 1 min, and 72°C for 1 min with a 5-s autoexten- sioukycle

4 Recover PCR products by removing as much of the aqueous reaction as possible from underneath the mineral oil

5 Purify PCR products by spin-column chromatography with Sephacryl-200 (see cDNA synthesis, Section 3.2., step 12)

6 If necessary, do a second round of PCR on the products from the first round (see Note 21)

7 Fifty nanograms of the PCR amplified subtracted cDNA are labeled with 32P-nucleotides exactly according to the instructions provided with the Random Primers Labeling Kit

3.7.2 Differential Screening of ;1 cDNA Libraries

with Subtracted PCR-Amplified Probes (See Notes 24 and 25)

Since the subtractions are performed in two directions, the two sub- tracted cDNAs are separately enriched for sequences preferentially gained or preferentially lost in one library relative to the other These subtracted DNAs are amplified by PCR as described above Once ampli- fied and labeled, they make highly sensitive differential probes to be used on the original libraries

1 Plate out 50,000-250,000 plaques from the original library at a density of 50,000 PFU/lSO mm plate (or 250,000/23 x 23 cm plate), and grow approx

6 h at 37°C

2 Make duplicate lifts from each plate, and fix the DNA by any preferred method (see ref 9)

26 Schweinfest et al

3 Prehybridize each filter with 0.033 mL Quik Hyb/cm2 filter for 15-30 min

at 65OC (see Note 22)

4 Remove a small aliquot of prehybridization solution, and combine it wrth the probe (which has been boiled for 5 min, and then chilled on ice) Use 2-10 x lo6 cpm/mL of solution

5 Add the aliquots back to each filter, and hybridize for 2 h at 65°C (see Note 23)

6 Wash the filters twice at room temperature in 2X SSPE and 0.2% SDS, and then twice at 55°C in 0.2X SSPE and 0.2% SDS Each wash is 30 min

7 Perform autoradiography

8 Pick all differential clones, and repeat the hybridizations at progressively lower plaque densities through second and third rounds until pure plaques

are obtained Using this method, we have been able to isolate clones repre-

senting mRNAs of 0.008% abundance (1)

4 Notes

1, RNazol (Tel-Test, Friendswood, TX) can be used in place of GTC for RNA isolation (IO) It is a simpler procedure that often results in higher yields However, in our hands, we have found the RNA isolated from tissues (but not from tissue culture) sometimes will not reverse transcribe The manu- facturer has included “additional steps” that should be taken in order to be able to use the RNA for reverse transcription

2 Make sure the mRNA is of high quality The quality of the mRNA can be assessed in several ways, if there is sufficient yield:

a A26dA2s, ratio near 2.0

b Northern blot analysis with probe to any high-mol-wt mRNA

c Ability to direct the in vitro translation of high-mol-wt proteins

We usually use two of these methods for quality assessment

3 Directional cDNA libraries are primed from their 3’ poly(A) tracts In order

to generate as complete a reverse transcript as possible, it is important that the RNA template be denatured prior to first-strand synthesis

4 The ratio of a-[32P]dATP to nonradioactive dATP in both first- and second-

strand syntheses is designed to be exactly the same (Note: First-strand nucle- otides carry over to the second-strand reaction.) This means that the specific activity of each strand is exactly the same Consequently, it is very easy to quantitate your yield of cDNA at all steps following ds-synthesis Although

it is not imperative that you use the same amount of radioactivity indicated here, you should maintain identical ratios in first- and second-strand syn- theses Our protocol results in ds cDNA of an SA of 6.67 x lo5 dpm/l.tg

5 Single-stranded cDNA (first-strand synthesis) should be made along with

a control RNA, preferably of high molecular weight (a 7.5-kb poly[A]-

Subtraction Hybridization 27

tailed RNA can be purchased from Gibco-BRL) Aliquots of these first- strand reactions are analyzed by alkaline agarose gel electrophoresis The control should yield a discrete, largely full-length band, and the tissue RNA should yield a smear rangmg from a few hundred nucleotides up to several kilobases ds cDNA can be analyzed by conventional agarose gel electro- phoresis This is always done in order to estimate the size of the cDNA prior to ligation with vector (see also Note 8)

6 3’-End cleavage of the linker primer with XhoI or EcoRI The XhoI linker primer is not methylated and is sensitive to digestion, whereas the XhoI sites that may exist within the cDNA are hemimethylated and will not cut with XhoI The EcoRI sites, however, behave somewhat differently Only fully methylated EcoRI sites (when the methylated nucleotide is 5-methyl deoxycytidine) are completely resistant to EcoRI digestion, whereas hemimethylated sites are partially resistant (11,12) This means that an excess of EcoRI must be used to assure cleavage of the linker primer EcoRI site-the internal cDNA sites will still be protected We have calculated that approx 80 U&g cDNA should be sufficient to digest hemimethylated EcoRI sites In practice, however, we divide this cDNA into three aliquots

in order to “bracket” the quantity of enzyme, i.e., 40, 80, 160 U&g After digestion, the aliquots are pooled again Digest each cDNA with its appro- priate enzyme for 1 h at 37OC in a volume of 50-60 l.rL

7 Sephacryl-400 may be used here instead of Sephacryl-200 By spinning the cDNA in a 5O+L vol, followed by several (two or three) 50-pL chases with 1X STB, it may be possible to get some size fractionation of the cDNA (largest cDNA elutes first),

8 It is a good idea to analyze an aliquot of ds cDNA by gel electrophoresis in order to determine an average size for the cDNA In this way, one can esti- mate more accurately the correct amount of cDNA to ligate to the vector at

an equimolar ratio Typically, the average size is l-2 kbp Since the vector (EcoRI.XhoI digested h ZAPII) is 40 kbp, this means that 25-50 ng cDNA are ligated with 1 pg of vector The amount of cDNA coprecipitated with the vector is deduced using the specific activity of the cDNA determined as in Note 4 and by counting a l-2 l,tL aliquot of the cDNA from step 27 For example, if one recovers 100 pL of cDNA from the spin column in step 26, its radioactive concentration is determined to be 4000 dprr@L in step 27, and its SA is 6.67 x lo5 dpm/pg (Note 4), then the concentration of cDNA recovered from the spin column is 4000 dprn&L divided by 6.67 x lo5 dprn/ p,g = 0.006 pg/l.t.L or 6 ng/p.L If the average size of the cDNA is 2 kbp, then

50 ng or 8.3 pL of cDNA are needed to coprecipitate with 1 pg of vector

9 Also, make sure to coprecipitate the test insert (provided by the manufac- turer) and vector as a positive control for ligation and packagmg

11 Helper R408 is not used since it is not kanamycin-resistant We find that kanamycin selection greatly improves the quality and yield of our phag- emid preps

12 The phagemid DNA should be analyzed by gel electrophoresis You should expect to see a smear starting at the molecular size of nonrecombinant ss pBluescript (-1.6 Kb with respect to ds DNA markers) and possibly some helper phage DNA

13 If the yield seems low (cl00 pg/L), it may be necessary to add some more helper at the time of the 50-fold dilution (step 8, above)

14 It is possible to purify the DNA further (e.g., in case there is a lot of helper DNA) by cutting out the ss DNA from a preparative gel and using GeneClean (BIO 101, La Jolla, CA) or GELase (Epicentre Technologies, Madison, WI)

15 Precipitated phage may also be purified by CsCl gradient centrifugation prior to DNA purification

16 The use of streptavidin (Gibco-BRL) instead of avidin D agarose for sub- traction works just as well

17 Further enrichment may be achieved by rehybridizing the subtracted ss DNA with more biotinylated ss DNA (l-10 pg) followed by another subtraction

18 In principle, it should also be possible to generate biotinylated nucleic acid for subtraction by using the T3 or T7 promoters in a hZAPI1 (along with the appropriate polymerase) to synthesize UTP-biotinylated RNA This would reduce the need to generate large amounts of driver ss phagemid for the hybridization

19 Individual colonies from the subtracted library can be grown up, and small- scale plasmid preps performed These plasmids, individually or in groups

up to five, are all digested so as to release their inserts (XhoI and EcoRI) Equal amounts are electrophoresed on duplicate agarose gels and then transferred to any preferred hybridization membrane The membranes are probed differentially with probes synthesized from the PCR-amplified sub- tracted cDNAs (see Sections 3.7.1 and 3.7.2.) We have also used probes synthesized directly as first-strand cDNAs from the original mRNAs, if sufficient material is available The PCR probes have the advantage of being enriched for sequences that are differentially expressed and are, theo-

Subtraction Hybridization 29

retically, limitless in supply, but they do contain vector sequences For this reason, it is advisable to excise the vector band (-3 kbp) from the gel before transfer and hybridization First-strand cDNA probes synthesized from the original mRNAs are not enriched (therefore, rare sequences in the mRNA

and more difficult to detect by Southern blot hybridization), but are free of vector sequences Clones that hybridize differentially are analyzed further

as good candidates for differentially expressed genes Differential South- ern blot hybridization has the disadvantage of being very tedious when large numbers of clones are analyzed

20 Differential colony hybridization has the advantage of being able to screen many colonies simultaneously The drawback is that duplicate colonies are not always quantitatively similar, making subtle differences m autora- diographic intensity somewhat unreliable Essentially, subtracted colonies from the 96-well microtiter plates are replicated onto duplicate 137-mm filters on 150-mm plates of LB + 50 l.tg/rnL ampicillin and grown over- night at 37OC The cells are lysed, and the DNA transferred to the filters by any preferred method Duplicate hybridizations are performed using first- strand cDNA prepared from total mRNA PCR-generated DNA probes cannot be used because of the presence of large amounts of vector sequences in the colony

21 Run a 5-10 pL aliquot of the PCR product on a 1% agarose gel, and look for a faint smear of DNA If none is visible, use 5-10% of the products of the first PCR to initiate a second round of PCR This time, however, use the SK and T7 primers, which are nested inside the first set of primers Use the same PCR conditions as the first round of PCR Purify these products through Sephacryl-200 spin columns, as before, and analyze by gel elec- trophoresis once more

22 Important: Prehybridization and hybridization should contain 10-20 pg/

mL heat-denatured pBluescript vector in order to compete with the vector sequences that are also present in the PCR-generated probe, which may hybridize to the pBluescript sequences in the XZAPII vector in the plaques

23 We find Stratagene’s Quik Hyb solution to be convenient and fast, but you may use any conventional prehybridization and hybridization conditions normally used to screen libraries

24 It is imperative that all candidate cDNA clones be verified as differential

by Northern blot hybridization to RNA, from which the original libraries were made Growth advantages during phage amplification or rescue or differential amplification during PCR could give a falsely positive (differ- ential) result

25 It is possible to estimate the efficiency of enrichment during the subtrac- tion hybridization by “spiking” the hybridization with varying known

30 Schweinfest et al

quantities of a previously cloned sequence known not to exist in the two libraries (e.g., bacterial KanR gene) In this way, the subtracted material can be assayed for degree of enrichment after transfection into E coli

2 Duguid, J., Rohwer, R G., and Seed, B (1988) Isolation of cDNAs of scrapte- modulated RNAs by subtractive hybridization of a cDNA library Proc Natf Acad Sci USA 85,5738-5742

3 Rubenstein, J L R., Brice, A E J., Ciaranello, R D., Denney, D., Porteus, M H., and Usdin, T B (1990) Subtractive hybridization system using single-stranded phagemids with directional inserts Nucleic Acids Res l&4833-4842

4 Owens, G P., Hahn, W E., and Cohen, J J (1991) Identification of mRNAs asso- ciated with programmed cell death in immature thymocytes Mol Cell Biol 11,

7 Chirgwin, J M., Przybyla, A E., MacDonald, R J., and Rutter, W J (1979) Isola- tion of biologically active ribonucleic acid from sources enriched in ribonuclease

10 Chomczynski, P and Sacchi, N (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction Anal Biochem 162,

156-159

11 Nelson, P S., Papas, T S., and Schweinfest, C W (1993) Restriction endonu- clease cleavage of 5-methyl-deoxycytosine hemimethylated DNA at high enzyme- to-substrate ratios Nucleic Acids Res 21,681-686

12 Brennan, C A., Van Cleve, M D., and Gumport, R I (1986) The effects of base analogue substitutions on the cleavage by EcoRI restriction endonuclease of octadeoxyribonucleotides containing modified EcoRI recognition sequences J Biol Chem 261,7270-7278

CIXAFJTER 3

Martin J nmms

1 Introduction RNase protection provides a sensitive method for detecting and quan- titating specific RNAs The method relies on the ability of ribonuclease

A and ribonuclease Tl to digest single-stranded RNA, but not perfectly base-paired double-stranded RNA In this respect RNA:RNA hybrids are more resistant to ribonuclease than RNA:DNA hybrids are to S 1 nuclease, resulting in fewer artifacts RNase protection has a number of advan- tages over Northern analysis in the quantitation of mRNA levels First, the hybridization of probe and target RNA takes place in a very small volume with very favorable renaturation kinetics (I) Second, poly(A)+ RNA is rarely required since 10 pg of RNA are sufficient for the detec- tion of mRNA species present at l-5 copies/cell Third, the RNase pro- tection method allows the discrimination between closely homologous sequences, allowing the detection of specific n-RNA species within a population of closely related sequences Fourth, RNase protection is par- ticularly suited to the quantitation mRNA species that are partially degraded (which is common with clinical samples) or too large to be found intact by Northern analysis, since the probe is generally signifi- cantly shorter than the target RNA

Figure 1 illustrates the assay in its simplest conception A radioac- tively labeled RNA is generated in vitro from a linearized DNA template

by run-off transcription from a bacterial promoter using the appropriate RNA polymerase Transcripts need to have some sequence that is not

31

Fig 1 Diagram outlining the RNase protection assay

homologous with the target RNA, which is usually provided by poly- linker sequences in the vector Template DNA is removed by digestion with DNase I and full-length RNA purified by polyacrylamide gel elec- trophoresis For quantitative measurements, an excess of radiolabeled probe is hybridized with target RNA, and following hybridization, ribo- nuclease is used to digest unhybridized probe and nonhomologous por- tions of RNA-RNA hybrid The protected fragments are resolved from any remaining undigested probe by polyacrylamide gel electrophoresis

A number of different applications use this general protocol In quantita- tive measurement of RNA, a transcription control, such as glyceraldehyde phosphate dehydrogenase (GAPDH), p-actin, or, P+ricroglobulin, can

RNase Protection Assay 33

be included in the same RNase protection as an internal reference standard Other common applications for RNase protections are mapping of transcrip- tion start and stop sites and the delineation of exon and intron junctions

This chapter will detail a method for quantitative measurement of RNA

using an internal transcription control The general method can be adapted to other qualitative purposes

2 Materials

High-quality deionized water, such as that produced with a Millipore Milli-Q purification system or other system giving high-quality water, should be used for making up all solutions

2.1 Stock Solutions Stored at Room Temperature

1 DEPC water: Add 0.1% (v/v) diethylpyrocarbonate to Milli-Q water, mix for 1 h, and autoclave

2 TE: 10 mM Tris-HCI, pH 7.5, and 1 mM EDTA Autoclave

3 0.5M EDTA: Adjust the pH of the acid form of EDTA with 1OM NaOH to

pH 7.5 and autoclave

4 7.5M ammonium acetate: Filter sterilize

5 2.OM ammonium acetate: Dissolve in DEPC water and filter sterilize

6 ChloroforrnIisoamyl alcohol: Analytical-grade chloroform containing 4% (v/v) isoamyl alcohol

7 10X TBE: 0.89M Tris-base, 0.89M boric acid, and 20 rnM EDTA

8 70% Ethanol: 70% (v/v) analytical-grade ethanol in DEPC water

9 100% Ethanol: analytical-grade ethanol

10 10% SDS: 10% (w/v) sodium dodecyl sulfate in water

2.2 Stock Solutions Stored at 4°C

1 Acrylamide stock: 29% (w/v) acrylamide and 1% (w/v) bisacrylamide

in water

2 6% gel mix: Dissolve 480 g of high-purity urea in 200 mL acrylamide stock and 100 mL 10X TBE, and adjust the volume to 1 L with water Gel mix can be stored for l-2 mo at 4°C Commercially available acrylamide mixes such as Acryl-a-Mix 6TM (Promega) give satisfactory results

2.3 Stock Solutions Stored at -20 “c

1 5X Transcription buffer: 200 rmI4 Tris-HCl, pH 7.5,30 mM MgC12, and 10

mM Spermidine (HCl)

2 D’lT: 100 mM dithiothreitol and 1 mM EDTA

3 NTPs: 10 mM each of ATP, CTP, GTP, and UTP (Boehringer) in 10 mM Tris base The pH of the ATP, GTP, and CTP solutions is adjusted to 7 with

7 Probe elution buffer: 0.5M ammonium acetate, 1 mM EDTA, 0.1% SDS

8 Hybridization buffer: 80% deionized formamide, 40 mM PIPES (pipera- zine-NJ/‘-bis-[Zethanesulfonic acid]), pH 6.4, 400 n&f sodium acetate,

pH 7.4, 10 mM NaCl, and 50% (w/v) glycerol

11 Proteinase K: 10 mg/mL Proteinase K dissolved in 10 mM Tris-HCl, pH 7.5, and 50% (v/v) glycerol

12 Yeast RNA: 5 mg/mL in water (see Note 1)

13 Buffer-saturated phenol: Phenol is melted at 6O”C, and an equal volume of

50 mM Tris-HCl, pH 9.0 added Following vigorous mixing, the phases are allowed to separate, and the upper (water) phase discarded Hydroxy quinoline 0.1% (w/v) is then added and stirred until dissolved Aliquot into lo-mL portions for freezing

2.4 ReagentsiSpecial Equipment

1 a-[32P]-UTP (>3000 Ci/mmol, 10 mCi/mL)

2 Y-[~*P]-ATP (3000 Ci/mmol, 10 mCi/mL)

3 SP6 RNA polymerase and T7 RNA polymerase (Promega) 20 U&L: Store

at -2OOC

4 DNase I (RNase-free): RQlTM (Promega) 1 U&L Store at -20°C

5 pUC 19 DNA-can be purchased commercially or prepared using standard methods (2)

6 Ribonuclease inhibitor: RNasin TM (Promega) 20 U/pL Store at -2OOC

7 Restriction enzyme HpaII: Supplied with appropriate 10X digestion buffer

8 Alkaline phosphatase (Promega): 1 U&L Store at -20°C

9 Sequencing gel apparatus and power supply (see Note 2)

10 Saran WrapTM

11 X-ray film: Kodak X-Omat or equivalent

RNase Protection Assay 35

12 Bind-silane (Silane A 25, Pharmacia-LKB)

13 Silane: 2% dimethyldichlorosilane in 1 ,1, 1 ,-trichloroethane

3 Methods 3.1 Preparation of DNA for Transcription

1 Digest 20 pg of appropriate plasmid in 200 p.L with a restriction enzyme that cuts downstream of the bacterial RNA polymerase promoter (see Note 3)

2 Extract twice with an equal volume of phenol-chloroform-isoamyl alco- hol (26:24:1) and then twice with chloroform using 2-mm spins in a microcentrifuge to separate phases

3 Precipitate the DNA with 100 pL of 7SM ammonium acetate and 700 pL ethanol at -70°C for 1 h

4 Recover the DNA by centrifugation, wash with 70% ethanol, and dry under vacuum

5 Resuspend the DNA in 20 yL TB This is sufficient DNA template for 20 transcription reactions

3.2 Preparation of Probe (see Notes 410)

1 To a sterile microcentrifuge tube add (in the following order at room tem- perature to avoid precipitation of the DNA template): 4 uL 5X transcrip- tion buffer, 2 pL 100 mM DlT, 4 pL NTP mix (minus UTP), 0.5 uL RNasin, 1 pL 0.1 rnM UTP (freshly diluted in water from a 10-m&I stock; see Note 4), 1 pL of linearized DNA template (1 ug/uL), and 5 uL u-[~~P]- UTP (see Note 5) and DEPC-H20 to 19 pL

2 Add 1 pL (20 U) of the RNA polymerase appropriate for the template being used (SP6,l7, or T3), mix gently, and incubate at 37°C for 1 h (see Note 6)

3 Add 1 pL of RQl DNase, and incubate for 1 h at 37OC

4 Add 20 pL of loading dye, and heat for 2 min at 95OC

5 Load a preparative 6% sequencing gel with an appropriate amount of tran- scription reaction (see Notes 7 and 8)

6 Run the gel at 25 V/cm for approx 1.5 h or until the bromophenol blue dye has run at least 15 cm

7 Dismantle the gel apparatus leaving the gel on one of the glass plates (see Note 9) Please note that appropriate Perspex shielding, which is always used with 32P, should be used judiciously at this stage to avoid excessive exposure

8 Cover the gel with Saran Wrap, and expose the gel to X-ray film for 2 min Cut or mark the film to allow the processed film to be easily aligned with gel

9 Place the autoradiograph behind the gel, and orient appropriately Cut out

a gel slice containing full-length RNA with a scalpel blade, transfer to a

11, Determine the level of radioactivity in 1 pL of probe by either liquid scm- tillation counting, Cherenkov counting, or another appropriate method

12 Store the probe at -2OOC

3.3 Preparation of Size Markers Although DNA size markers are not totally accurate for determining the size of RNA on denaturing polyacrylamide gels, they serve as good markers for comparison of gels and for approximate size estimates A good set of size markers can be made by end-labeling a digest of plasmid pUC19 cut with HpaII, which has been dephosphorylated with alkaline phosphatase (see Note 11)

1 Cut 20 pg of pUCl9 to completion with HpuII in a volume of 200 pL using an appropriate digestion buffer

2 Add 0.4 pL (0.4 U) of alkaline phosphatase, and incubate for 30 min at

37OC

3 Add 4 l,tI of 0.5M EDTA

4 Heat at 68°C for 15 min to inactive phosphatase enzyme

5 Extract twice with an equal volume of phenol-chloroform-isoamyl alco- hol (25:24:1) and then twice with chloroform using 2-min spins in a microcentrifuge to separate phases

6 Precipitate the DNA with 100 pL of 7.5M ammonium acetate and 700 lrL ethanol at -7OOC for 1 h

7 Recover the DNA by centrifugation, wash with 70% ethanol, and dry under vacuum

8 Resuspend the dephosphorylated DNA in 10 pL TE

9 To a microcentrifuge tube add: 1 p.L of dephosphorylated DNA, 1 l.tL 10X kinase buffer, 7 ltL HzO, 1.5 pL Y-[~~P]-ATP, and finally 0.5 FL (10 U) of T4 polynucleotide kinase

10 Mix gently and incubate for 1 h at 37°C Then inactivate the enzyme by adding 90 pL of TE and heating for 10 min at 8OOC

11 Equilibrate a NAP-5 column with 10 mL of TE

12 Load the kinased DNA onto the column, followed by an additional 400 l.tL

of TE

13 Elute the labeled DNA with 1 mL of TE, and store at -2OOC

RNase Protection Assay 37

Fig 2 Purification of probes on 6% acrylamide gels Series of probes labeled with a-[32P]-UTP and run on a 6% acrylamide sequencing gel as described in Section 3 ‘The autoradiograph was produced with a 3-min exposure Track 1: GAPDH control probe made with m polymerase using 25 pM unlabeled UTP

in addition to 50 pCi of CX-[~~P]-UTP Tracks 2-4: a series of probes made with T7 polymerase using 2.5 pMunlabeled UTP Note that probe made with 25 piI4 unlabeled UTP is almost all full-length product, whereas probes made with 2.5 pit4 unlabeled UTP vary in the degree of full-length product

3.4 Hybridization and RNase Digestion

(See Notes 12-18) For quantitative RNase protection assays, the quantity of probe should

be in excess of the target RNA (see Note 12 and Fig 2)

1 To 1.5~mL microcentrifuge tubes, add 5-50 pg of sample RNA (see Note 13) For each probe used, set up two control tubes containing 10 yg yeast RNA (see Note 14)

2 Add 0.2-1.0 x 105 cpm of both the assay probe and the control probe to each tube (see Note 12)

3 Adjust the volume in each tube to 30 pL with DEPC-treated water, add 10

pL 2M ammonium acetate, 100 pL 100% ethanol, mix with a vortex mixer, and precipitate RNA at -8OOC for a minimum of 15 min

4 Centrifuge for 15 min at 4OC at top speed

7 Leave the tube lids open for 15-20 min to allow remaining ethanol to evaporate Do not vacuum dry the RNA pellet since this may result in difficulties in resuspending the pellet

8 Resuspend the pellet in 20 PL hybridization buffer Gently vortex and heat the samples at 50°C to aid resuspension

9 Denature RNA by heating for 5 min at 95°C

10 Briefly centrifuge

11 Incubate for 16-24 h at 45°C in a heat block or oven (see Note 15)

12 Centrifuge briefly to ensure that the hybridization solution is at the bottom

of the tube

13 Make an appropriate quantity of diluted stock ribonuclease A/T1 mixture

in RNase digestion buffer, usually a l/1000-l/4000 dilution (see Note 16)

14 Add 200 ILL of digestion buffer containing ribonuclease to each of the sample tubes and one of control tubes containing yeast RNA Add 200 l.tL

of RNase digestion buffer without ribonuclease to the second control tube

15 Mix and incubate at 30°C for 30 min (see Note 17)

16 To each tube, add 10 pL of 10% SDS, 10 uL proteinase K, and 5 pL yeast RNA

17 Mix, briefly centrifuge, and incubate at 37OC for 15 min

18 Add 250 p,L of phenol-chloroform to each tube and vortex for 30 s

19 Centrifuge for 5 min at room temperature

20 Carefully transfer upper aqueous phase to a new microcentrifuge tube

21 Add 625 FL 100% ethanol, mix, and precipitate the RNA at -80°C for a minimum of 15 min

22 Centrifuge for 15 min at 4°C Make sure tubes are consistently oriented m the centrifuge so that the position of the pellet can be predicted This makes

it easier to remove the supernatant without disturbing the pellet

23 Remove all of the supernatant and respin briefly

24 Remove all of the remaining liquid, carefully avoiding the small RNA pellet

25 Allow the residual ethanol to evaporate with the tubes open

26 Add 5-10 pL of gel loading solution, warm the tubes at 50°C to aid resuspension, and mix by gentle vortexing (see Note 18)

3.5 Gel Analysis of Protected Fragments

(See Notes 19-21 and Table 1)

1 Pour a 6% sequencing gel using 50 mL gel mix containing 30 lt.L TEMED and 300 PL of freshly prepared 10% ammonium persulfate When using a

RNase Protection Assay 39

Table 1 Troubleshooting Common Problems in RNase Protection Assays

No signal Insufficient RNA

Insufficient probe

Bands smeared Excessive salt carryover

from ethanol precipitation Urea in gel not sufficiently pure

Large number of bands Insufficient ribonuclease to

above and below digest unhybridized probe

correctly sized

protected fragment

Protected band smaller RNARNA hybrid has regions

than expected of high A-U content

Allelic variation between probe and target mRNA Heterogeneity in target mRNA

Increase RNA amount (see Note 12) Increase probe specific activity (see Note 21)

Increase amount of probe (see Note 22)

Ensure that all ethanol is removed after last ethanol precipitation (see Section 3.3., step 24) Purchase high quality urea or deionize urea with ion exchange resin (see Note 24)

Increase level of nbonuclease (see Note 15)

Reduce level of ribonuclease (see Note 25)

Carry out ribonuclease digestion

at a lower temperature (see Note 26) Perform digestion with ribonuclease

Tl only (see Note 26) Optimize digestion conditions (see Note 27)

Choose a probe in a less hetero- geneous portion of the mRNA (see Note 28)

MacrophorrM system, a 0.4~mm thick gel with 20 x 20 cm glass plate and 20-well comb with 4-mm wide wells produces satisfactory results (see Notes 19 and 20; Fig 3)

2 Preheat the gel to 50°C

3 Dilute 1 pL of the 32P-labeled size markers (Section 3.2.) in gel loading buffer to an activity of lO,OOO-20,000 cpm/pL

4 Dilute the probe control sample (minus RNase treatment) 1:50 in gel load- ing solution, and transfer 5 pL to a new tube for loading on to the gel

5 Heat samples for 2-3 min at 90°C prior to loading

6 Load samples and size markers, and run the gel at 20-30 V/cm for approx

1 h or until the bromophenol blue dye has run to within 1 cm of the end of the plate, or 18-20 cm from the wells when using plates longer than 20 cm

Phosphoimagcr IL-4 3.20 3.10 2.94 2.65

units ( s 104) P2-MG 1.44 1.46 1.42 1.34 1.32 1.30 1.29 1.22 0.63 2.59 1.29

Fig 3 Sample RNase protection showing titration of probe and ribonuclease Probes for murine interleukin-4 (IL-4) and &+nicroglobulin @*-MC) were pre- pared as described in Section 3 The IL-4 probe was synthesized with 2.5 piV unlabeled UTP and the &-MG probe with 25 piI unlabeled UTP The full- length probes and protected fragments are 404 and 329 bp for IL-4 and 193 and

143 bp for P,-MG RNA was extracted from murine EL4 cells stimulated with PMA and ionomycin using the guanidinium isothiocyanate method (6) Quanti- tative measurement of radioactivity in bands corresponding to protected frag-