computing the pseudo inverse of a matrix

Báo cáo khoa học: Key substrate recognition residues in the active site of a plant cytochrome P450, CYP73A1 ppt

Báo cáo khoa học: Key substrate recognition residues in the active site of a plant cytochrome P450, CYP73A1 ppt

... 48 N302D 5¢-CATTGTTGAAGACATCAATGTTG-3¢ 5¢-CAACATTGATGTCTTCAACAATG-3¢ 43 N302F 5¢-CTTTACATTGTTGAATTCATCAATGTTGCAGC-3¢ 5¢-GCTGCAACATTGATGAATTCAACAATGTAAAG-3¢ 43 I30 3A 5¢-CATTGTTGAAAACGCTAATGTTGCAG-3¢ ... 5¢-GTTCGAGAACAATGAATGTTGTGTTC-3¢ 5¢-GAACACAACATTCATTGTTCTCGAAC-3¢ 55 R103E 5¢-GAACACAACATTCTCTGTTCTCGAACC-3¢ 5¢-GGTTCGAGAACAGAGAATGTTGTGTTC-3¢ 55 DKR 5¢-GAAGTTAAAGATACAATGATTCAGCTC 5¢-GAGCTGAATCATTGTAACTTTAACTTC-3¢ 48 N302D ... 5¢-CCCTCCGTCTCTTTATGGCGATCCG-3¢ 5¢-CGGGATCGCCATAAAGAGACGGAGGG-3¢ 50 I371F 5¢-TCCGTATGGCGTTCCCGCTTCTAGTC-3¢ 5¢-GACTAGAAGCGGGAACGCCATACGGA-3¢ 58 I37 1A 5¢-TCCGTATGGCGGCTCCGCTTCTAGTC-3¢ 5¢-GACTAGAAGCGGAGCCGCCATACGGA-3¢

Ngày tải lên: 17/03/2014, 10:20

12 381 0
The Gospels in the Second Century An Examination of the Critical Part of a Work Entitled ''''Supernatural Religion'''' pptx

The Gospels in the Second Century An Examination of the Critical Part of a Work Entitled ''''Supernatural Religion'''' pptx

... indirectly, on the moral and spiritual nature of man that can be settled by the bare reason. A certain amount of sympathy is necessary in order to estimate the weight of the forces that are to be analysed: ... [_ibid._] [Matt 2.1.] there came Magi _from Arabia_, who knew by a star that had appeared in the heaven that a [Matt 2.2.] king had been born in Judaea Having paid Him their homage [Matt 2.11.] ... birth of Christ must undergo a more searching examination, by minds of different nationality and training, both as to the date, text, and character of the several books. The whole balance of an argument

Ngày tải lên: 17/03/2014, 15:20

162 498 0
THE CHEMICAL HISTORY OF A CANDLE A COURSE OF LECTURES DELIVERED BEFORE A JUVENILE AUDIENCE AT THE ROYAL INSTITUTION ppt

THE CHEMICAL HISTORY OF A CANDLE A COURSE OF LECTURES DELIVERED BEFORE A JUVENILE AUDIENCE AT THE ROYAL INSTITUTION ppt

... to the pound. They have been replaced since then by the steel-mill, and then by the Davy-lamp, and other safety-lamps of various kinds. I have here a candle that was taken out of the _Royal ... into that out -of -the- way place a sort of wax which a kind friend has sent me, and which forms a new material for the manufacture of candles. And how are these candles made? I have told you about ... have one of the most beautiful illustrations of the general nature of a candle that I can possibly give. The fuel provided, the means of bringing that fuel to the place of chemical action, the

Ngày tải lên: 22/03/2014, 14:20

164 272 0
Internal Audit 2012*: A study examining the future of internal auditing and the potential decline of a controls-centric approach docx

Internal Audit 2012*: A study examining the future of internal auditing and the potential decline of a controls-centric approach docx

... U.S.-centric approach to business and accounting And in the United States, the internationalization of accounting standards may lead to a change in the language of accounting • The ... language of China, Mandarin As the company expands internationally, its internal audit activities... internationalization of accounting standards are forcing companies to rethink a ... have a direct impact on talent, and there are notable ties between what participants had to say about the role of internal audit and the changes they expect to see in organizational

Ngày tải lên: 23/03/2014, 04:20

68 456 0
Báo cáo khoa học: Odorant binding protein has the biochemical properties of a scavenger for 4-hydroxy-2-nonenal in mammalian nasal mucosa doc

Báo cáo khoa học: Odorant binding protein has the biochemical properties of a scavenger for 4-hydroxy-2-nonenal in mammalian nasal mucosa doc

... spectro- photometrically in the ultrafiltrates on the basis of the absorbance at 223 nm. The number of HNE covalent adducts ⁄ equivalent of OBP was finally calculated by sub- tracting the values determined in the ... tracheobronchi- al tree, nasal mucosa and sweat glands [25]. Human tear lipocalin has significant sequence homology with the human forms of OBP and, at least in humans, par- tially shares a similar tissue ... radical intermediates generated as a consequence of oxidative metabolism. They can react with virtually all classes of biological molecules and are responsible for most of the cellular damage caused by oxidative

Ngày tải lên: 23/03/2014, 10:20

12 386 0
Báo cáo khoa học: The crystal structure of a hyperthermostable subfamily II isocitrate dehydrogenase from Thermotoga maritima pdf

Báo cáo khoa học: The crystal structure of a hyperthermostable subfamily II isocitrate dehydrogenase from Thermotoga maritima pdf

... 5’-CACGACTGAGCGAAGCTCATGATCGATTTCTCCAGG-3’ 5’-AAAAGGTCGACATCTGGATGGCGACGAAAGACACGATC-3’ 5’-GATCGTGTCTTTCGTCGCCATCCAGATGTCGACCTTTT-3’ D36N-1 5’-CATCCTTCCCTATCTCAACATCCAGCTGGTTTACT-3’ D341N-1 5’-AAGGGGAGAACTCAACGGAACACCGGAGG-3’ ... 5’-AAGGGGAGAACTCAACGGAACACCGGAGG-3’ 5’-CACTCTCGAAGAGTTCATAAACGAAGTGAAGAAGAATCTC-3’ 5’-GAGATTCTTCTTCACTTCGTTTATGAACTCTTCGAGAGTG-3’ F205M... to the thermotolerance of TmIDH Comparison of ion pairs and hydrogen ... 50% occupancy each (Lys A4 8, Lys A6 2, Glu A8 1, Lys A8 4, Arg A1 09, Lys A1 83, Lys A2 20, Asn A2 40, Glu A3 00, Arg A3 07, Arg A3 08, Arg A3 35, Glu A3 48, Glu A B C Fig. 2. (A) Ribbon representation of the Thermotoga

Ngày tải lên: 23/03/2014, 10:21

18 413 0
Báo cáo khoa học: Structure of the core oligosaccharide of a rough-type lipopolysaccharide of Pseudomonas syringae pv. phaseolicola docx

Báo cáo khoa học: Structure of the core oligosaccharide of a rough-type lipopolysaccharide of Pseudomonas syringae pv. phaseolicola docx

... respectively, as well as a trace amount of terminal Rha. These data could be accounted for by the attachment of Kdo III in OS NaOH -II to the same position 6 of one of the Glc residues as Rha in OS NaOH -I, ... spectra of OS HOAc showed essentially the same correlation pattern as the corresponding spectra of the core oligosaccharides obtained by mild-acid degradation of the P. aeruginosa LPS [35,36]. Particularly, ... nitrogen-bearing carbons (C2 of Ala, GalN and GlcN) at d 50.3, 51.0 a nd 56.8, carbonyl groups of the acyl groups and a carboxyl group (C1) of Kdo I at d 172–176 and an O -carbamoyl group (NH 2 CO) at d

Ngày tải lên: 23/03/2014, 13:20

10 326 0
Changing only the aesthetic features of a product can affect its apparent usability pptx

Changing only the aesthetic features of a product can affect its apparent usability pptx

... participants rated the aesthetics and usability of each of model, then used them, then rated them again for both aesthetics and usability. The order of rating (usability-aesthetics or aesthetics-usability) ... completion or task completion. Another notable feature of these results is the way that the usability and aesthetics ratings strongly parallel one another. In both cases there is a large effect of Model ... participant in an experiments is asked to rate a design they imagine themselves in a particular situation and make some evaluation of Apparent Product Character and then what the Consequences of this

Ngày tải lên: 23/03/2014, 13:20

13 352 0
Báo cáo khoa học: Inhibition of a-synuclein fibrillization by dopamine analogs via reaction with the amino groups of a-synuclein Implication for dopaminergic neurodegeneration pot

Báo cáo khoa học: Inhibition of a-synuclein fibrillization by dopamine analogs via reaction with the amino groups of a-synuclein Implication for dopaminergic neurodegeneration pot

... Spectrophotometric characterization of the reactions of DA analogs with a- Syn and some amino acids. (A) UV-vis spectra of a- Syn with DA, CA, HQ and Q after reaction for 24 h. The a- Syn alone sample was as a control. ... several days, and then the fibrillization at different intervals was measured by ThT fluorescence assay. The concentration of a- Syn was 200 l M and the fibrillization of a- Syn alone was as a comparison. Data ... (Markham Ontario, Canada). All other reagents were of analytical quality. Expression and purification of a- Syn and a- Syn 1)60 a- Syn and a- Syn 1)60 genes were subcloned into the pET- 3a vector, and

Ngày tải lên: 23/03/2014, 15:20

12 416 0
Đề tài " The two possible values of the chromatic number of a random graph " pot

Đề tài " The two possible values of the chromatic number of a random graph " pot

... Annals of Mathematics The two possible values of the chromatic number of a random graph By Dimitris Achlioptas and Assaf Naor Annals of Mathematics, 162 (2005), 1335–1351 The two possible values ... This lemma is a variant of the classical Laplace method of asymptotic analysis in the case of the Birkhoff polytope Bk , i.e., the set of all k × k doubly stochastic matrices For a matrix A ∈ Bk ... sum of n!/[(n/k)!]k indicator variables, one for each balanced partition, we see that to calculate EZ it suffices to consider all pairs of balanced partitions and, for each pair, bound the probability

Ngày tải lên: 29/03/2014, 07:20

18 510 0
Báo cáo khoa học: Inhibitor-mediated stabilization of the conformational structure of a histone deacetylase-like amidohydrolase pptx

Báo cáo khoa học: Inhibitor-mediated stabilization of the conformational structure of a histone deacetylase-like amidohydrolase pptx

... integrated in the analysis software biokine32 F(t) is the observed fluorescence of the protein at time t after the start of the reaction and B is the background signal A1 and A2 are the amplitudes of ... Ray et al [31] and Chakrabarti et al [32], although the observed changes in the biophysical parameters were much smaller as compared with the denaturation of HDAH Saturating concentrations of ... intermediate in the absence of denaturant and the equilibrium meq value meq is a parameter which reflects the change in compactness of HDAH upon denaturation The parameter is proportional to the surface

Ngày tải lên: 30/03/2014, 08:20

11 394 0
Báo cáo khoa học: Protein dissection enhances the amyloidogenic properties of a-lactalbumin potx

Báo cáo khoa học: Protein dissection enhances the amyloidogenic properties of a-lactalbumin potx

... poly- peptide chain to form the amyloid cross-b structure. As a matter of fact, the MG of LA attains an even more flexible conformational state dur- ing the early phases of the aggregation process at acidic ... rendering the aggregated desb-LA and Th1-LA somewhat pro- tected from degradation. Analysis of fibrillogenesis of intact, nicked and gapped LA by FTIR To evaluate the conformational rearrangements of LA and ... intensity. Overall, the FTIR data indicate that the aggregation processes of LA and Th1-LA are similar, but that Th1-LA aggregates significantly fas- ter. The aggregation process of desb-LA, followed

Ngày tải lên: 30/03/2014, 16:20

13 327 0
Báo cáo Y học: The regulatory subunit of a cGMP-regulated protein kinase A of Trypanosoma brucei docx

Báo cáo Y học: The regulatory subunit of a cGMP-regulated protein kinase A of Trypanosoma brucei docx

... 2001 the alteration of transcription via PKA-mediated phos- phorylation of transcription factors. Interestingly, in at least in some instances, the activity of mammalian PKA appears to be stimulated ... value is almost 200-fold higher than the apparent activation constant of mammalian PKA (120 n M; [17]). Binding of cGMP was not affected by cAMP, up to an excess of at least 100-fold. Again, the ... cGMP rather than by cAMP [22]. In the unicellular eukaryote Trypanosoma brucei, the causative agent of human sleeping sickness in Africa, cAMP signalling and its role in parasite proliferation and

Ngày tải lên: 31/03/2014, 23:20

10 497 0
Measuring the Economic Value of a City Park System docx

Measuring the Economic Value of a City Park System docx

... as private natural areas such as cemeteries, university quadrangles, and corporate campuses.) Third, the amount and characteristics of rainfall are calculated from U.S weather data The model ... of parkland Their aesthetic value is not countable, but the value of the air pollution they extract is The Air Quality Calculator determined... Department of Parks and Recreation ... Philadelphia parks have support galore In fact, there are more than 100 “friends of parks” organizations Two of them, the Philadelphia Parks Alliance and Philadelphia Green, operate on a citywide...

Ngày tải lên: 02/04/2014, 08:20

28 386 0
The five dysfunctions of a team a leadership fable

The five dysfunctions of a team a leadership fable

... company, and she had played a key... automobile manufacturing plant, a U.S.Japanese joint venture She held that job for the better part of a decade and made the plant one of the ... executives often said that Martin was the keeper of the crown jewels That analogy was due at least in part to the fact that Martin was British Martin considered himself to know as much about ... he had the most ill-defined role of anyone on the team Nick was of cially the chief operating of cer of the company,... that Mikey was unaware of how she came across to others

Ngày tải lên: 02/04/2014, 14:23

242 560 1
Outline môn Tiếng Anh - What are the good and bad points of advertising from the view point of a consumer?

Outline môn Tiếng Anh - What are the good and bad points of advertising from the view point of a consumer?

... Advertising leaflets can not create the trust for customers The customers usually receive the leaflets after that they throw away or if they read it but they can’t remember information of the suppliers ... many times a day so they can easily recognize brand name of the suppliers  The customers are very impressed by the images that the suppliers advertised in the television It’s look lively, real, ... TOPIC 13 By what means can a product or a servicebe advertised? Briefly present the strengths and weaknesses of each means  A product or a service can be advertised by many means such as: Television,

Ngày tải lên: 02/06/2014, 15:10

20 865 0
báo cáo hóa học:" A process evaluation of the scale up of a youth-friendly health services initiative in northern Tanzania" pot

báo cáo hóa học:" A process evaluation of the scale up of a youth-friendly health services initiative in northern Tanzania" pot

... at the end of each activity Ongoing evaluation None: evaluation at end of training Daily evaluation with answers provided Intervention materials Materials Training manual only Trainers’ manual ... at the discretion of the district authorities. Finally, towards the end o f 2005, the Ministry of Health and Social Welfare (MoHSW) launched a YFS training manual (Manual 2) as part of a new Adolescent ... RESEARC H Open Access A process evaluation of the scale up of a youth-friendly health services initiative in northern Tanzania Jenny Renju 1,2 , Bahati Andrew 1 , Kija Nyalali 1 , Coleman Kishamawe

Ngày tải lên: 20/06/2014, 08:20

12 371 0
Báo cáo y học: "Mutations in matrix and SP1 repair the packaging specificity of a Human Immunodeficiency Virus Type 1 mutant by reducing the association of Gag with spliced viral RN" ppsx

Báo cáo y học: "Mutations in matrix and SP1 repair the packaging specificity of a Human Immunodeficiency Virus Type 1 mutant by reducing the association of Gag with spliced viral RN" ppsx

... dimerization state and splicing of viral RNA (A) Dimerization analysis of virion RNA Virion RNAs of different proviral constructs were separated on a native agarose gel and characterized by Northern ... mRNA compared to the wild type; 3- to 5-fold less HIV-1 mRNA was associated with the revertant Figure Characterization of the association between Gag and HIV-1 RNA (A) Measurement of the association ... RNA in the SL1 deletion virion was replaced by host RNA and that the virion maintained an RNA level similar to that of wild type To characterize the cellular RNA packaged into the wildtype and...

Ngày tải lên: 13/08/2014, 01:20

12 300 0
The Marketing Strategy of a multinational join stock company.doc

The Marketing Strategy of a multinational join stock company.doc

... another main task of the department • Financial and Accounting department: this department deals with all financial and accounting matters Another main function is to manage the use of capital ... 5D The Marketing Strategy of a multinational join stock company if they take care of their customers, market share and profits will follow Creating customer values and satisfaction is at the ... company and distribution of ideas, goods, and services to create exchanges that satisfy individual and organizational goals”2 The writer of the book The Silk Road to International Marketing” had...

Ngày tải lên: 27/10/2012, 16:51

25 625 8
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG ... prosthetic metal Arch Biochem Biophys 313, 296–303 Yamakura, F., Rardin, R.L., Petsko, G .A. , Ringe, D., Hiraoka, B.Y., Nakayama, K., Fujimura, T., Taka, H & Murayama, K (1998) Inactivation and...

Ngày tải lên: 21/02/2014, 01:21

12 741 0
w