checking the status of a locationprovider

Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"

Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"

... IgG, Santa Cruz Biotech, CA) The assay was developed using a stabilized HRP substrate All samples were analyzed in the linear range of the ELISA using over-expressed human Vgf as a standard Assessment ... prevents the early phase of diet-induced obesity Proc Natl Acad Sci USA 2006; 103(39): 14584-14589 Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez ... 100 µl of goat anti rabbit IgG and 10 µl of normal rabbit serum (Peninsula Laboratories Inc., San Carlos, CA) dissolved in RIA buffer After incubating at room temperature for 1.5 hr, the reactions...

Ngày tải lên: 03/11/2012, 10:52

8 504 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... 5¢-CGCGGATCC ACCGTAGACACTTATGATATA-3¢ and 5¢-CGCCTCCA CCTAAGAGGCATCCTTGTCCAC-3¢; rOMM-64-II, 5¢CGCGGATCCACCGTAGACACTTATGATATA-3¢ and 5¢-CGCCTCGAGCTAAGAGTCAGCTTGCACGTC-3¢; rOMM-64-III, 5¢-CGCGGATCCGCTGATGTGACCAGT ... ATCCAGGCAAGATTTTAAGCATCCA-3¢ and 5¢-CGCC TCCACCTAAGAGGCATCCTTGTCCAC-3¢; rOMM-64C, 5¢-CGCGGATCCGACTCAGTGGATGACCAATCC-3¢ and 5¢-CGCCTCGAGCTAAGAAGACTGGGCTGCC AG-3¢) that had 5¢ adapters corresponding to BamHI ... 5¢-CGCGGATCCGCTGATGTGACCAGT GATGAC-3¢ and 5¢-CGCCTCGAGCTATTTGGGCTCTT TCATCAT-3¢; rOMM-64-IV, 5¢-CGCGGATCCGCCCCT GTTAATGATGGAACC-3¢ and 5¢-CGCCTCGAGCTAA GAAGACTGGGCTGCCAG-3¢; rOMM-64-V, 5¢-CGCGG ATCCAGGCAAGATTTTAAGCATCCA-3¢...

Ngày tải lên: 18/02/2014, 17:20

12 577 0
CREATING A SUPPORTIVE ENVIRONMENT FOR ELDERLY WITH CHRONIC ILLNESS potx

CREATING A SUPPORTIVE ENVIRONMENT FOR ELDERLY WITH CHRONIC ILLNESS potx

... front- line paid care workers and volunteers reflected that the linkage between hospitals and social welfare agencies was inadequate (Department of Social Work and Social Administration, HKU, ... from paid care workers are essential for maintaining daily functioning, they are not the most appropriate source of care in situations involving unpredictable and idiosyncratic needs Comparatively ... equipme nt, such as leg braces and wheel chairs The safety of a home environment can also be enhanced by means of home modification By installing handrails, smoke detectors, and other devices to...

Ngày tải lên: 22/03/2014, 14:20

7 507 0
Creating a glass object with max and vray

Creating a glass object with max and vray

... this For the lighting I have used an Omni light, V-ray shadows cheked and on V-ray shadows parameters check Transparent shadows and area shadow Use a plane for the scene and assign a white color ... If you wish to make the bottom of the glass thicker just select the bottom of the glass and drag it down I have modified the shape of the glass by using the Taper tool from the Modifiers list ... Shell (is available only for Max as I know), and adjust the thickness of the object how you like Now to make the special for of the glass we need to cut a little of the top, using booleans We will...

Ngày tải lên: 01/04/2014, 17:32

15 280 0
picture yourself building a website with joomla! 1.6[electronic resource] step-by-step instruction for creating a high-quality, professional-looking site with ease

picture yourself building a website with joomla! 1.6[electronic resource] step-by-step instruction for creating a high-quality, professional-looking site with ease

... 2-2 Joomla! 1.6 Admin control panel Each icon opens to a dedicated administration area of the back-end Alternate Administrator Access You can access additional areas of the administrator back-end ... After the installation, an administrator username/password is needed to access the Joomla! back-end 16 Fast Track Start J oomla! 1.6 can be daunting at first to get a grasp of the whats and hows of ... use it After you create a database, you must associate a user with a username and password with the database Joomla! asks you for that information during the installation process so, again, write...

Ngày tải lên: 29/05/2014, 23:54

320 860 0
Báo cáo sinh học: "Aurora Kinase A expression is associated with lung cancer histological-subtypes and with tumor de-differentiation" doc

Báo cáo sinh học: "Aurora Kinase A expression is associated with lung cancer histological-subtypes and with tumor de-differentiation" doc

... follows: AURKA.FW: GAGATTTTGGGTGGTCAGTAGATG, AURKA.RW: TAGTCCAGCGTGCCACAGAGA, ESD.FW:TGTTGTC ATTGCTCCAGATACCA, ESD.RW:CCCAGCTCTCAT CTTCACCTTT, POLR2B.FW:CCTGATCATAACCAG TCCCCTAGA,OLR2B.RW:GTAAACTCCCATAGCCT ... clinical and laboratory data, data analysis and data interpretation and drafted the manuscript MP and GVS participated in study design and coordination, data analysis and interpretation and drafted ... defects can account for cellular and genetic changes that characterize prostate cancer progression Cancer Res 2001, 61:2212-2219 Sakakura C, Hagiwara A, Yasuoka R, Fujita Y, Nakanishi M, Masuda K,...

Ngày tải lên: 18/06/2014, 19:20

6 303 0
báo cáo hóa học:" Functional bracing for delayed union of a femur fracture associated with Paget''''s disease of the bone in an Asian patient: a case report" pot

báo cáo hóa học:" Functional bracing for delayed union of a femur fracture associated with Paget''''s disease of the bone in an Asian patient: a case report" pot

... functional brace in the treatment of delayed union of the tibia [13-15] We speculate that this treatment was advantageous because the external fixator and functional bracing did not violate the fracture ... this article as: Takigami et al., Functional bracing for delayed union of a femur fracture associated with Paget's disease of the bone in an Asian patient: a case report Journal of Orthopaedic ... disease in Australia, New Zealand, North America and most European countries, but it has a low incidence in Scandinavia, and is extremely rare in the Japanese population, with a prevalence of...

Ngày tải lên: 20/06/2014, 04:20

4 403 0
Báo cáo lâm nghiệp: "Do trees use reserve or newly assimilated carbon for their defense reactions? A 13 C labeling approach with young Scots pines inoculated with a bark-beetle-associated fungus (Ophiostoma brunneo ciliatum" pptx

Báo cáo lâm nghiệp: "Do trees use reserve or newly assimilated carbon for their defense reactions? A 13 C labeling approach with young Scots pines inoculated with a bark-beetle-associated fungus (Ophiostoma brunneo ciliatum" pptx

... immediately after inoculation, resulted in a drop of predawn needle water potential Ψwp , a severe stomatal closure and a large decline of net CO2 assimilation A reduction of the area of the induced-reaction ... mobilize carbon around the points of attack [7] Synthesis of secondary metabolites is a very costly process in terms of energy and depends on the availability of carbohydrates close to the attack points ... respond the fungal spread may rely more on the availability of current assimilates from the foliage [5] Abiotic factors, such as nutrient supply and water relations, have the potential to modify the...

Ngày tải lên: 07/08/2014, 16:21

8 412 0
Báo cáo lâm nghiệp: " Scots pine responses to number and density of inoculation points with Leptographium wingfieldii Morelet, a bark beetle-associated fungus" docx

Báo cáo lâm nghiệp: " Scots pine responses to number and density of inoculation points with Leptographium wingfieldii Morelet, a bark beetle-associated fungus" docx

... compared between modalities Means are presented with their standard error Analysis of variance (ANOVA) was achieved using SAS software (SAS Institute, Cary, NC, USA), and differences between means ... bluestained, dried and resin-soaked sapwood were were measured on the discs (figure 1) Data were obtained by drawing the areas on a transparent paper and by measuring them with a planimetre (ΔT ... 3-weekold malt agar culture was inserted, with the fungus side close to the sapwood Thereafter, the bark plug was returned to maintain the mycelium, and to avoid contamination [32] on a MATERIALS AND...

Ngày tải lên: 09/08/2014, 04:20

10 170 0
Báo cáo khoa học: "Three synchronous primary carcinomas in a patient with HNPCC associated with a novel germline mutation in MLH1: Case report" docx

Báo cáo khoa học: "Three synchronous primary carcinomas in a patient with HNPCC associated with a novel germline mutation in MLH1: Case report" docx

... The patient's father died of colon cancer shortly after diagnosis at age 55, and three other paternal family members had cancer in an unknown site The patient's paternal grandmother died at an ... chemotherapy consisting of cisplatin and taxol combined with radiotherapy, and is disease-free at the time of publication A comprehensive family history was taken and a formal pedigree was assembled ... complication The urothelial cell carcinoma was high-grade, pT3 N2 Mx, Stage IV, and the more advanced colon adenocarcinoma was moderately differentiated, pT3 N1 Mx, Stage IIIB The patient received adjuvant...

Ngày tải lên: 09/08/2014, 04:21

6 481 0
Báo cáo y học: "Complex regional pain syndrome with associated chest wall dystonia: a case report" ppt

Báo cáo y học: "Complex regional pain syndrome with associated chest wall dystonia: a case report" ppt

... significantly changed after baclofen treatment (Table 1) She was maintained at a dose of 600 μg/day of intrathecal baclofen and has been asymptomatic in regard to lethargy, weakness, nausea, headaches, ... years and the one autopsied had a six year course suggesting that axial dystonia is a late manifestation of the syndrome Intrathecal baclofen is effective in treatment of the limb dystonia of ... intrathecal baclofen was added at an initial dose of 75 μg/day Baclofen was up titrated by approximately 50 μg/day every two weeks to a final dose of 600 μg/ day The patient experienced symptomatic...

Ngày tải lên: 10/08/2014, 10:20

4 457 0
báo cáo khoa học: "Co-existence of acute myeloid leukemia with multilineage dysplasia and Epstein-Barr virus-associated T-cell lymphoproliferative disorder in a patient with rheumatoid arthritis: a case report" docx

báo cáo khoa học: "Co-existence of acute myeloid leukemia with multilineage dysplasia and Epstein-Barr virus-associated T-cell lymphoproliferative disorder in a patient with rheumatoid arthritis: a case report" docx

... anti-RNP antibody, and anti-SS -A antibody Bilateral hand X-rays showed mild swelling and destruction of the metacarpo-phalangeal (MP) and proximal-inter-phalangeal (PIP) joints He was diagnosed to have ... (Figure 1A) , and a diagnosis of AML-MLD was made based on World Health Organization (WHO) criteria [4] The immunophenotype of blasts was CD7, 13, 33, 34, and HLA-DR positive, and an abnormal karyotype, ... Hoshida Y, Xu JX, Fujita S, Nakamichi I, Ikeda J, Tomita Y, Nakatsuka S, Tamaru J, Iizuka A, Takeuchi T, Aozasa K: Lymphoproliferative disorders in rheumatoid arthritis: clinicopathological analysis...

Ngày tải lên: 10/08/2014, 22:20

6 319 0
Báo cáo y học: "A dentigerous cyst associated with bilaterally impacted mandibular canines in a girl: a case report" potx

Báo cáo y học: "A dentigerous cyst associated with bilaterally impacted mandibular canines in a girl: a case report" potx

... dentigerous cyst was larger than was apparent on the digital pantomograph The cyst encompassed the crowns of both the right mandibular canine and the left mandibular canine The border of the dentigerous ... position of the canines and the dentigerous cyst The resultant data were reconstructed, and multi-planar and orthoradial views were examined The coronal and axial slices revealed that the dentigerous ... curettage, and exposure of the mandibular canines PG performed the histological examination of the biopsy All authors read and approved the final manuscript Competing interests The authors declare that...

Ngày tải lên: 10/08/2014, 23:21

4 320 0
Báo cáo y học: "Fibrous dysplasia of bone associated with softtissue myxomas as well as an intra-osseous myxoma in a woman with Mazabraud’s syndrome: a case report" pptx

Báo cáo y học: "Fibrous dysplasia of bone associated with softtissue myxomas as well as an intra-osseous myxoma in a woman with Mazabraud’s syndrome: a case report" pptx

... implantation A histopathological examination of the intra-muscular lesion showed a myxoma As a unique finding, histopathological examination of the intra-osseous lesion in the lateral tibial plateau ... with a proximal femoral nail, as well as allograft fixation with AO screws of the tibia Page of Figure Lateral X-ray of the whole left leg This X-ray shows the situation after fibrous dysplasia ... polyostotic form of fibrous dysplasia is present in the vast majority of patients In general, the onset of fibrous dysplasia antedates the appearance of intra-muscular myxomas, and the soft-tissue...

Ngày tải lên: 10/08/2014, 23:21

7 592 0
báo cáo khoa học: "Oculomotor nerve palsy associated with bortezomib in a patient with multiple myeloma: a case report" pps

báo cáo khoa học: "Oculomotor nerve palsy associated with bortezomib in a patient with multiple myeloma: a case report" pps

... metabolite was not assessed at the time of the adverse event There is insufficient animal and in vitro data regarding the association of cranial nerve palsy with bortezomib as a possible adverse ... 30353, AlKhobar, 31952, Saudi Arabia 2Radiology Department, Saad Specialist Hospital, Prince Faisal Bin Fahed Street, P.O Box 30353, AlKhobar, 31952, Saudi Arabia Authors’ contributions HE analyzed ... antagonists and neuropathy Journal of Muscle Nerve 2008, 37(3):281-292 Ravaglia S, Corso A, Piccolo G, Lozza A, Alfonsi E, Mangiacavalli S, Varettoni M, Zappasodi P, Moglia A, Lazzarino M, Costa A: Immune-...

Ngày tải lên: 11/08/2014, 02:21

4 270 0
Báo cáo y học: "Aplastic anemia associated with interferon alpha 2a in a patient with chronic hepatitis C virus infection: a case report" pptx

Báo cáo y học: "Aplastic anemia associated with interferon alpha 2a in a patient with chronic hepatitis C virus infection: a case report" pptx

... M, Vaziri MZ, Bagheri N, Sabaghi F, Talebian A: Association of aplastic anaemia and Fanconi’s disease with HLA-DRB1 alleles Int J Immunogenet 2008, 35:453-456 19 Ramos-Casals M, Garc a- Carrasco ... hypogammaglobulinemia or abnormal bands A computed tomography examination of the patient’s abdomen and thorax was unremarkable The patient’s bone marrow biopsy was profoundly hypocellular with a decrease in all ... presentation, late onset of AA), it is unlikely that the HCV infection alone was the cause of his ensuing AA Bone marrow aplasia may also occur as an idiosyncratic drug reaction, with a sudden onset after...

Ngày tải lên: 11/08/2014, 03:21

5 354 0
Báo cáo khoa hoc:" Anaphylactic reaction associated with Ranitidine in a patient with acute pancreatitis: a case report" pdf

Báo cáo khoa hoc:" Anaphylactic reaction associated with Ranitidine in a patient with acute pancreatitis: a case report" pdf

... and proof reading of the manuscript RSY has approved the final manuscript All authors have read and approved the final manuscript Acknowledgements Discussion Ranitidine is a H2 receptor antagonist ... to a commonly used drug like ranitidine can take the clinician by surprise Although the management for this is to treat the anaphylaxis, it is important that the clinician is aware of this adverse ... find any association between allergies to metronidazole and buscopan and the development of an anaphylactic reaction to ranitidine Consent was obtained from the patient for publication of study...

Ngày tải lên: 11/08/2014, 10:22

2 321 0
Báo cáo khoa hoc:" Papillary carcinoma arising in a thyroglossal duct cyst with associated microcarcinoma of the thyroid and without cervical lymph node metastasis: a case report" pot

Báo cáo khoa hoc:" Papillary carcinoma arising in a thyroglossal duct cyst with associated microcarcinoma of the thyroid and without cervical lymph node metastasis: a case report" pot

... thyroglossal duct cyst, the central portion of the body of the hyoid bone, and a core of tissue around the thyroglossal tract to open into the oral cavity at the foramen cecum[1] In case of malignancy, ... Concurrent papillary and squamous carcinoma in a thyroglossal duct cyst: A case report Can J Surg 1996, 39:328-332 Luna Ortiz K, Hurtado-Lopez LM, Valderrama-Landaeta JL, Ruiz-Vega A: Thyroglossal duct ... anterior part of the neck between the thyroid cartilage and hyoid She was in good health otherwise and her past medical history was unremarkable A cervical ultrasound showed a lesion which appeared...

Ngày tải lên: 11/08/2014, 10:23

3 311 0
w