challenge—and a new game

... parochial - concern that is occasionally laid at the door of social accounting: namely, has it failed? 3 Has Social Accounting Failed? Despite the challenges that social accounting has attracted, ... that project has actually been a noted success Certainly applying any label of “failure” to social accounting seems unwarranted But has social accounting managed to develop or maintain a creative ... University Trang 3Social Accounting Research As if the World Matters: Postalgia and a new absurdism Abstract This essay- principally directed at the academy - considers the question “Has the social accounting

Ngày tải lên: 11/12/2016, 11:13

... of an enslaved African American woman He headed west when he was given his freedom A pass he found through the Sierra Nevada later became part of the overland trail to California Kit Carson was ... 1836 Santa Anna’s army was then defeated by Sam Houston’s troops in April 1836, and Santa Anna was captured In exchange for his freedom, Santa Anna promised not to try to recapture Texas However, ... power, and in 1824 he was arrested and shot Santa Anna surrenders to Sam Houston, who was wounded in the Battle of San Jacinto. 11 Santa Anna declared that Mexico was now a republic Men were given

Ngày tải lên: 11/02/2017, 14:59

... of an enslaved African American woman He headed west when he was given his freedom A pass he found through the Sierra Nevada later became part of the overland trail to California Kit Carson was ... 1836 Santa Anna’s army was then defeated by Sam Houston’s troops in April 1836, and Santa Anna was captured In exchange for his freedom, Santa Anna promised not to try to recapture Texas However, ... power, and in 1824 he was arrested and shot Santa Anna surrenders to Sam Houston, who was wounded in the Battle of San Jacinto. 11 Santa Anna declared that Mexico was now a republic Men were given

Ngày tải lên: 18/04/2017, 15:54

... Renzaburō’s childhood Renzaburō’s father, Shibata Tomota was a local landlord and a painter in the traditional Japanese style Shibata Tomota died when Renzaburō was three years old, and Shibata ... technically part of Kanagawa prefecture, Hiyoshi lies halfway between Tokyo and Yokohama), at the time Shibata was attending the Keiō preparatory 23 Nakamura Katsuzō, Shibata Renzaburō shishi ... Shibata’s characteristic cold and unsparing irony According to Nakamura Katsuzō, “What Shibaren [Shibata Renzaburō] gleaned from the spirit of those poets was opposition to authoritarianism, antagonism

Ngày tải lên: 02/04/2018, 10:02

... across koans, they were dazzling to me I was in Australia, and theonly meditation training available at that time was there wasn’t any, actually Hathayoga was happening, and there was an intellectual ... three majorpractice traditions—Zen, Tibetan Vajrayana practice, and vipassana or mindfulness—Zenand Vajrayana are highly modified for a specific cultural niche, East Asia in the former caseand Indo-Tibetan ... notingtechnique associated with Theravada Buddhism, and I emphasize a strong ethicalparadigm, also based on the Theravada tradition That’s what I now teach The other thing Idiscovered was that if you interactively

Ngày tải lên: 22/04/2019, 13:45

... measured around the curvature, or 1.3mm in a orsomewhatclubbedampulla andabroadlyitiformdiverticulum almostaslong(left)orabout dig-immature penialseta prostateduct internal plications A spermathecalduel ... poresmediantoalines.Last hearts inXII.(Spermathecal ductat leastonefourththe 4.Maleporeswellmedianof alines.Moderately smallworms <3mmwide 7*.millaamillaa Maleporesin selal linesaor ab Fairly large worms ... composite,ingofasmanyas4parallelconjoinedtubes ap-proximatelyaslongas thesperrnatheca . Spermathecal pores2 pairs 17.Spermathecal pores 2pairs, in5/6and6/7 t , 7".montislewisi(part) Spcrmathecal pores

Ngày tải lên: 20/07/2019, 10:01

... contains seven family scales: family conflicts, poor family management, parental attitudes fa-vorable towards drug use and parental attitudes fafa-vorable towards antisocial behavior, family attachment, ... towards marijuana FR_5 Parental attitudes favorable to antisocial behavior R44a Favorable attitude towards skipping school R44f Favorable attitude towards stealing R44g Favorable attitude towards ... in AIA Those three CTC-family subscales are “poor family management” and especially “parental attitudes favorable to drug use” (α = 0.40) and “parental attitudes favorable to antisocial behav-ior”

Ngày tải lên: 27/02/2020, 13:09

... load, dynamic response and vibration are studied a lot Shariyat and Alipour [3] investigated bending and stress analysis of variable thickness FGM auxetic conical/cylindrical shells with general ... of Transport and Communications, 03 Cau Giay, Dong Da, Hanoi, Vietnam 3 VNU University of Sciences, Vietnam National University, Hanoi, Department of Mathematics, Mechanics and Informatics, ... decreases as the ratio h a increases (thicker plates) and vice / versa Whereas, in the case the same value of / h a , deflections’ value  w increase when increasing /b a and vice versa Table 2 Effect

Ngày tải lên: 11/05/2020, 11:34

... load, dynamic response and vibration are studied a lot Shariyat and Alipour [3] investigated bending and stress analysis of variable thickness FGM auxetic conical/cylindrical shells with general ... of Transport and Communications, 03 Cau Giay, Dong Da, Hanoi, Vietnam 3 VNU University of Sciences, Vietnam National University, Hanoi, Department of Mathematics, Mechanics and Informatics, ... decreases as the ratio h a increases (thicker plates) and vice / versa Whereas, in the case the same value of / h a , deflections’ value  w increase when increasing /b a and vice versa Table 2 Effect

Ngày tải lên: 04/02/2021, 05:05

... load, dynamic response and vibration are studied a lot Shariyat and Alipour [3] investigated bending and stress analysis of variable thickness FGM auxetic conical/cylindrical shells with general ... of Transport and Communications, 03 Cau Giay, Dong Da, Hanoi, Vietnam 3 VNU University of Sciences, Vietnam National University, Hanoi, Department of Mathematics, Mechanics and Informatics, ... decreases as the ratio h a increases (thicker plates) and vice / versa Whereas, in the case the same value of / h a , deflections’ value  w increase when increasing /b a and vice versa Table 2 Effect

Ngày tải lên: 18/03/2021, 10:38

... very high thermal stability, and other special properties, make Pcs and metallo Pcs suitable for many applications In particular, lanthanide and lutetium series metallo Pcs attract attention in ... tetraphthalocyanine has been synthesized and the charge transport mechanism investigated.56−59 2 Ball-type phthalocyanines Ball-type or face-to-face diphthalocyanines were thought of as a new ... concept around 2000 One already published compound60 was found to be appropriate to prepare a ball-type Pc, but all attempts to make that compound Trang 3a ball-type Pc failed In the meantime, a group

Ngày tải lên: 12/01/2022, 23:20

... Trang 1Thomas Margetts: A new Milton manuscript, and a new defender of the people of EnglandJoad Raymond A gift In or before 1725 a Thomas Margetts gave his friend J Tayler a book, and Tayler ... Government Margetts’ correspondence (and Baynes’ correspondencewith others) shows him working with, and occasionally acting as a financial agent for Adam Baynes, an army officer who was also a client ... Dinah (named after her grandmother) who married Richard Day; Isabella who married William Turner; and Elizabeth Margetts (bapt 9 May1675), who was in 1688 unmarried There is no evidence of any

Ngày tải lên: 20/10/2022, 22:46

... unpopular ideas and beliefs is not alwayspleasant for an audience, and even in the most liberal nations there mayoccasionally be private actors who, when confronted with such speech,choose to react ... peace, this time because of a silent protest in a segregatedpublic library.46 Once again, the Court said that there had been no breach of the peace, and that even if the peaceful protest had ... sub-stantially disrupting a school’s educational mission.91 Posner proceeded to analyze the school’s forecast of a substantialdisruption, and particularly its contention that student harassment

Ngày tải lên: 23/10/2022, 05:35

... competency after admission to the bar It appears to be a classic case of locking the stable door after the horse has escaped, i.e after a partly educated and untrained lawyer is given a license to practice ... after another Thereafter, graduation from a law school approved by the American Bar Association (ABA) became under most state statutes the sole requirement for taking the bar examination, which in ... exception of a recently created California State Bar Committee on the practi-cal training of law students, there has been only one move by a state board of law examiners and a state supreme court

Ngày tải lên: 02/11/2022, 12:04

... Annals of Mathematics, 164 (2006), 1033–1064 Analytic representation of functions and a new quasi-analyticity threshold By Gady Kozma and Alexander Olevski˘ ı* Abstract We characterize ... boundary value of a Nevanlinna class function That example is L∞ and can be made continuous, but it cannot be made smooth in any reasonable sense without leaving the Nevanlinna class 2.4 The harmonic ... n∈Z where ω satisfies (9) As far as we are aware this condition has never appeared before as a smoothness threshold We mention that whereas the usual quasi-analyticity is placed near the “right...

Ngày tải lên: 29/03/2014, 07:20

... California from the 1990 Cens us In this sample a block group on average includes 1425.5 individuals living in a geographically compact area Naturally, the geographical area included varies inversely ... D.S Bromhead and D Lowe, “Multivariable functional interpolation and adaptive networks”, Complex Systems, vol 2, 1988, pp 321-355 J.Park and I.W Sandberg “Approximation and radial-basis-function ... NOISE DATA With training in equally spaced nodes, the HDH-1 phase can be apply in many applications which needs fast training time such as in computer graphics, pattern recognition To get the maximum...

Ngày tải lên: 12/04/2014, 15:40

... Piracicaba – SP Piracicaba – SP Piracicaba – SP Piracicaba – SP Brasília – DF Brasília – DF Acreuna – GO Presidente Olegário -MG Holambra – SP Primavera Leste – MT Primavera Leste – MT Primavera Leste ... Location1 Cotton sp Cultivar Isolate Date Symptom2 Nested PCR Cascavel – PR Cascavel – PR Cascavel – PR Cascavel – PR Cascavel – PR Sta Helena de Goiás – GO Piracicaba – SP Piracicaba – SP Piracicaba ... typical typical typical typical typical typical typical typical typical typical typical typical typical typical atypical typical typical atypical typical typical atypical typical + + + + + + + + + +...

Ngày tải lên: 20/06/2014, 01:20

... space onto a real normed linear space is a linear mapping up to translation Baker [12] showed an isometry from a real normed linear space into a strictly convex real normed linear space is a ne ... Sciences, Hanyang University, Seoul 133-791, Korea Department of Mathematics, Faculty of Science and Arts, Celal Bayar University, 45140 Manisa, Turkey ∗ Corresponding author: cihangiralaca@yahoo.com.tr ... An introduction to 2-fuzzy n-normed linear spaces and a new perspective to the Mazur–Ulam problem Choonkil Park1 and Cihangir Alaca∗2 Department of Mathematics, Research Institute for Natural...

Ngày tải lên: 20/06/2014, 21:20

... residual data set the ML-PDA algorithm is applied and the resulting track estimate validated If a new target is validated, its associated measurements are also edited out to form a new residual data ... frames of data, track estimates separated by fewer than Nw frames are correlated in that they use common data frame(s) EURASIP Journal on Advances in Signal Processing Table 3: Scenario parameters ... optimization routine be at a local maximum That is for the bearing, range, range rate measurement, the LLR will be at a constant (local maximum) value for all values of tangential velocity In areas...

Ngày tải lên: 22/06/2014, 19:20

... TTTTGCGGCCGCCMNNMNNMNNGCAGCAGCCGGGGCAGCA AATACGACTCACTATAGGGA GTAATCCAGAGGTTGATTCTCGAGAAAA TTTTAAGCTTGCCACCATGGCCGGATCCTAAGCGGCCGCAGCAAGGGCGAGGAG CTG 10 CCCCATCGATCTCGAGTTACTTGTACAGCTCGTCCAT 11 ACCTACAGGTGGGGTCTTTCATTCCC ... 12 AGCTCGTTTAGTGAACCGTCAGATC 13 GACAAGCGGCCGCTTAAGAACCGC 14 AAACTCGAGTTAGCGGCCGCCCCTCCACATGCAG 15 AAAGCGGCCGCCAGAACCGCAGCACCCGGGGCA 16 TTTGCGGCCGCATGGATGATGATATCGCCGCG 17 TTTCTCGAGCTAGAAGCATTTGCGGTGGAC ... TTTCTCGAGCTAGAAGCATTTGCGGTGGAC 18 CTCAGATCTCGGGCTATGGATGATGATATCGCCGC 19 TCGAGATCTGAGTCCGGACTTGTACAGCTCGTCCATG 20 TTTAAGCTTGCCACCATGGATTACAAGGATGACGACGATAAGGGATCCGCCGGAT CCTTTTTGAATTG 32 Table 1.2 Continued 21 TTTAAGCTTGCCACCATGGTGTACCCCTACGACGTGCCCGACTACGCCGGATCCG...

Ngày tải lên: 13/11/2014, 10:46