... it That means flying through the thunderstorm; embracing turbulence, not avoiding it; taking risks; trusting (but also testing) your intuitions; doing the unexpected This is not to say that there ... opportunities that exist in the midst of crisis and to move fast to exploit them Chapter Three uses the story of how I created Intel Israel in the first place to describe the special qualities that leaders ... exaggerate the “existential threat” of terrorism to keep people in a state of constant anxiety; on the other, they promise perfect security—on the condition, of course, that the public support their...
Ngày tải lên: 16/03/2014, 21:03
... relationships with distributors of Caribbean music to get their films distributed, since these distributors already have an established and thriving market Still, what is more 43 important is that ... distribution and all of those things there, that are the elements that constitute the structural framework of an industry, I don t think you can say that there exists in Africa, even though there ... out of the basement of cinema and into the mainstream of society, particularly the society it comes out of is the subject of the fifth chapter of this document Before that this discussion there...
Ngày tải lên: 07/03/2014, 15:20
báo cáo khoa học: "Why don’t hospital staff activate the rapid response system (RRS)? How frequently is it needed and can the process be improved?" potx
... It is not clear to what extent this study may be limited by the frequency of poor outcomes that can be directly attributed to a failure to call for help One of the important aspects of this study ... similar situations The rationale given for the clinical staffs’ predictions may not always be obvious, even to them This ‘sixth sense’ of being able to project the future state is often the result of ... a poor outcome if a patient becomes critically ill We hypothesise that an effective MET system will minimise this risk by reducing the occurrence of critical deterioration in ward patients Timely...
Ngày tải lên: 10/08/2014, 10:23
Báo cáo y học: " The electronic version of this article is the complete one and can be found onlin" pot
... biologists can go to any talk by any other biologist, whether they are a structural biologist or a cell biologist or a geneticist or an immunologist or a genome scientist, and understand most of ... But I don t understand what this has to with this month’s column Mink: By this point, neither our readers, I suspect But here’s what I think we should tell them I think we should tell them that ... sciences, the real problem is that most biologists can t understand chemists and physicists and hardly any chemists and physicists know what to make of the typical biology seminar, with its lists of...
Ngày tải lên: 14/08/2014, 08:20
Báo cáo y học: "The electronic version of this article is the complete one and can be found online" potx
... with proteins that display positively charged domains On this basis it was originally thought that the HS chains were essential for glypican activity Indeed, this seems to be the case for the ... Hh to the receptor Patched (Ptc) triggers the signaling pathway by blocking the inhibitory activity of Ptc on Smoothened GPC3 competes with Ptc for Hh binding The interaction of Hh with GPC3 triggers ... is based on the ability of glypicans to facilitate and /or stabilize the interaction of Wnts with their signaling receptors, the Frizzled proteins (Figure 2) [22] This hypothesis is based on the...
Ngày tải lên: 14/08/2014, 08:21
Báo cáo y học: "The electronic version of this article is the complete one and can be found online at" pps
... http://genomebiology.com/2004/5/11/R90 (a) DD|394579 DV|206736 ACCCCATGT -TTATGTCTTTTTTTTATTCTGAT TTTGCCGCTTGACATTTTGCTAAAAATTTCACAAGACGTTGTC ATTCATTGTGCCCTTTGCAGTGCGTTCTGATTTTCGCGCTTTGCCGCTTGACATTTTGTAAATTTTTTCACAAGACGGAATC ... tTGAAAtTCtTTaTCgc pep*-fur1 4.56 -116 gTGAtAtTGAaaTTCtT 394231 -122 tTGAcAtTGAaaaTCAT AraC-type regulator tTGAtttTGAgTTTCAT cTGgtttTCATTaTCAT FoxR GGDEF domain protein 3.91 4.72 tTGAAAATCATTTTCgc ... AcaAAAATCAaTTTCAa 208641 fld* -195 -189 tTGAcAtTGATTTTCgT ? tTGActtTGATTTTCAc tTGAtttTCgTTTTCAa genY*(C)-genZ* Regulator, Zn-dependent peptidase, ABC operon 3.91 5.18 tTGAtttTCAcTTTCAT 209238...
Ngày tải lên: 14/08/2014, 14:21
Tài liệu Detailed Guide: Prostate Cancer Can Prostate Cancer Be Found Early? pptx
... lubricated finger into the rectum to feel for any bumps or hard areas that might be a cancer The prostate gland is found just in front of the rectum, and most cancers begin in the back part of the ... other PSA tests If your PSA test result is not normal, ask your doctor to discuss your cancer risk and your need for further tests [Digital Rectal Exam (DRE) During this exam, a doctor inserts ... might be able to be followed without being treated right away (an approach called "watchful waiting" or “expectant management”) Until more information is available, whether you have the tests is...
Ngày tải lên: 24/12/2013, 21:15
Khắc phục lỗi “Your profile can not be used because it is from a newer version of Google Chrome” ppsx
... drives): T m đến file web data xóa file này: Lưu ý không thực chắn làm thao t c này, đổi t n file thành web data.bk Sau khởi động Google Chrome, bạn thấy thông báo lỗi biến m t: Chúc bạn thành công! ... Trong vi t sau, thảo luận cách khắc phục vấn đề Mở Windows Explorer chuyển t i đường dẫn: C:UsersYOURUSERNAMEAppDataLocalGoogleChromeU ser DataDefault (thay YOURUSERNAME với t n t i khoản ... (thay YOURUSERNAME với t n t i khoản hệ thống): Chuyển sang chế độ hiển thị t t file ẩn hệ thống mục Folder Options (Start > Folder Options > Folder Options > View > Hidden files and folders...
Ngày tải lên: 12/07/2014, 16:20
Báo cáo y học: "Remission in psoriatic arthritis: is it possible and how can it be predicted" pdf
... Sign test Chi square test for categorical data and Mann-Whitney U test for continuous data were used to evaluate the statistical significance of the difference between the two independent groups, ... treatment was fully in compliance withthe Helsinki Declaration and the analysis was approved by the St Vincent's University Hospital ethics committee Statistics Statistical analysis was performed ... of
Ngày tải lên: 12/08/2014, 14:21
Bài tập lớn thiết kế dầm cầu bê tông cốt thép nhịp đơn giản với chiều dài nhịp L = 21m, khổ cầu K = 8, Lan can T = 1,5m
... =25,2 3T Tơng t ta có giá trị nội lực: Stt Mômen (T. m) Lực c t( T) Q1 25,23 M1 37,843 Q4 M2 Q2 Giá trị nội lực t nh toán nội lực tiêu chuẩn m t c t thứ i t nh theo công thức *Với t hợp t i trọng ... VII .T nh toán cờng độ theo ứng su t tiếp ứng su t nén ch T nh toán chống n t nghiêng theo ứng su t kéo chủ VII.1 T nh duy t m t c t cách gối L/4=8.6 m theo ứng su t tiếp -Thớ kiểm tra thớ trục trung ... dầm chủ: T. T T n đặc trng hình học Diện t ch ti t diện ngang m t c t Mô men t nh mép dới dầm Khỏang cách t trọng t m ti t diện (TTTD) đến mép dới dầm Mô men quán t nh m t c t Kí hiệu F Trị số...
Ngày tải lên: 19/03/2015, 17:32
Phòng tránh say nắng, ngã nước, côn trùng cắn… cho bé
... s t bơi nước Phòng tránh: Muỗi thường xu t từ lúc chiều t i đến đêm khuya chỗ nước t đọng Có thể sử dụng DEET, ch t không màu, có t nh sánh dầu có mùi Hiện nay, loại hoá ch t DEET sản phẩm t t ... 3.579 người ch t đuối năm 2006 Trong số đó, ¼ trẻ em 14 tuổi Khoảng 514 người ch t bơi thuyền Cần ý để tránh bị tai nạn xe đạp Phòng tránh: Luôn quan s t trẻ trẻ tiến t i gần m t nước Không nên ... su t Chữa trị: Dùng đá miếng chườm lạnh ibuprofen để giảm sưng ong đ t Dùng kem chứa hydrocortisone làm cho v t muỗi cắn đỡ khó chịu M t liều Benadryl giúp v t ong cắn không bị t i t Ch t đuối...
Ngày tải lên: 24/10/2012, 15:03
Why johnny can't sell
... from that issue is that you can benefit a lot from even basic testing You don 't need to get heavily into statistical theory to make yourself a lot more money with it Before that, we got into a ... well up to this point, it's not a critical a step The best way to this right is to create a picture in their mind that evokes all the emotional benefits at one time You don 't tell them the value ... sequence before going to the letter, and get more emails after putting off the decision, that's fine You don 't want to leave that as a door for them to exit through by putting an opt-in form late in...
Ngày tải lên: 31/10/2012, 17:10
Cận cảnh bề mặt hành tinh Đỏ
... Hố Ulysses khu vực t p trung nhiều núi lửa Hỏa, có núi lửa lớn mang t n Olympus Mons Những đường kẻ hình cưa t o carbon dioxide phía nam hành tinh Đỏ Đường uốn lượn phía t y Ladon Valles Hỏa ... phía t y Ladon Valles Hỏa khiến nhà khoa học cho nước t n hành tinh Đỏ Bức hình gần giống vân tay khổng lồ cho k t nước bốc Miệng núi lửa Victoria với đường kính khoảng 0,8 km ...
Ngày tải lên: 19/09/2013, 03:10
I CAN’T SEE CLEARLY NOW
... behavior, might constitute a deceptive or unfair practice.”3 The emphasis here is on might—to this day, no official regulations or guidelines as to what constitutes subliminal advertising exist Designed ... advertisers in an attempt to attract us to a product, then it is even more prevalent than anyone has ever realized After all, in today’s overstimulated world, countless things slip beneath our ... scary to find out that what we thought had the least to with smoking is actually the most effective in making us want to smoke, and that the logo—what advertisers and Designed by Trung Pham Tuan...
Ngày tải lên: 17/10/2013, 18:20
Điều tra đánh giá loại hình đất bền vững tại huyện hà trung tỉnh thanh hóa
... t i 36 tri u t n thóc Mu n ñ t ñư c s trên, nư c ta ph i trì t i thi u tri u hecta ñ t lúa v ñ có th gieo tr ng bình quân tri u hecta/năm Trong ñó, m t s t nh ð ng b ng sông H ng, mi n Trung, ... Ngoài t nh tr ng ô nhi m phân bón, thu c b o v th c v t, ch t th i, nư c th i ñô th , khu công nghi p Ho t ñ ng canh t c ñ i s ng thư ng xuyên b ñe b i t nh tr ng ng p úng, lũ l t, lũ qu t, ñ t trư ... ng thu s n Nð: Ngô ñông NN: Nông nghi p PTNT: Ph t tri n nông thôn TCN: Cơ quan nhà nư c, t ch c tr , t ch c tr xã h i, t ch c s nghi p c a nhà nư c TKH: T ch c khác nư c TKT: T ch c kinh t TNHH:...
Ngày tải lên: 06/12/2013, 19:49
lỗi the page can not be displayed của CHM
... Đã làm hướng dẫn không được ? page can not be displayed Ai đó cứu với, khẩn cấp lắm rồi , sau nó dịch toàn bị lỗi the ...
Ngày tải lên: 13/12/2013, 10:08