... individual cells in a small cell population Chemicals but especially particles can interact with single cells within a cell population and only induce a response at a certain threshold concentration, ... of nanoparticles Studies of cel-lular processes and determination of toxic effects of nanomaterials on cells are commonly based on examin-ing the response of a cellular population, such as a cell ... generated data The MCC represents an array of miniaturized cell culture chambers for permanent non-invasive characterization of individual cells in a cell layer The miniaturization of the cell
Ngày tải lên: 21/06/2014, 00:20
... B Yang, “On the norm of a Hilbert’s type linear operator and applications,” Journal of Mathematical Analysis and Applications, vol 325, no 1, pp 529–541, 2007. 7 B G Pachpatte, “On some new ... inequalities with a best constant factor as well as some particular examples are considered Trang 32 A Lemma and Two Equivalent InequalitiesLemma 2.1 If λ < 2, k λ x, y is a nonnegative homogeneous ... functions and a Hardy’s integral inequality, a Hilbert-Hardy-type integral operator is defined, and the norm of operator is obtained As applications, a new Hilbert-Hardy-type inequality similar to Hilbert-type
Ngày tải lên: 21/06/2014, 07:20
Báo cáo toán học: "On a new family of generalized Stirling and Bell numbers" pps
... second kind S(n, k) appear in the normal ordering of (XD)n, or, in the variables used here, con-in the boson annihilation a and creation operator a† satisfying the commutation relation aa† − a†a ... Trang 1On a new family of generalized Stirling and Bell numbersMathematics Subject Classification: 05A15, 05A18, 05A19, 11B37, 11B73, 11B75 Abstract A new family of generalized Stirling and ... it was assumed that h ∈ C\{0} and s ∈ N0 The parameter h should be considered as a free “deformation parameter” (Planck’s constant) and we will often consider thespecial case h = 1 The dependance
Ngày tải lên: 08/08/2014, 14:23
DSpace at VNU: Notes on a new approximate solution of 2-D heat equation backward in time
... Trang 1Notes on a new approximate solution of 2-D heat equation backwardin time Nguyen Huy Tuana,d,⇑, Dang Duc Trongb, Pham Hoang Quanc a Institute for Computational Science and Technology, Quarter ... interest of backward heat equations also comes from financial mathematics, where the celebrated BlackScholes model[17] for call option can be transformed into a backward parabolic equation whose form ... b is a regularization parameter depending onand it is chosen latter The real number a P 1 is a constant.The case f = 0, a = 1 is considered in[19] The major reason to choose a P 1 is explained
Ngày tải lên: 14/12/2017, 16:24
Comprehensive anticancer drug response prediction based on a simple cell line-drug complex network model
... demonstrated an observation on the CCLE and GDSC datasets, i.e., genetically similar cell lines always exhibit higher response correlations to structurally related drugs Based on this observation ... available data for investigating anticancer drug response They are benchmark compilations of gene expression, gene copy number and massively parallel sequencing data We se-lected 491 cancer cell ... normalized the drug response data such that all cell line susceptibility data have the same baseline and the same range (see Fig.1as an example) Generalized observation For the first question,
Ngày tải lên: 25/11/2020, 13:16
a pharmaco epistasis strategy reveals a new cell size controlling pathway in yeast
... NADþfrom Na was large and did not respond to extracellular Na (Figure 5D, black bars) In this mutant, intracellular Na concentration was high and NADþ concen-tration was low compared with wild ... Control of cell size by the Sir2/60S pathway respond to NADþvariations (A) Schematic representation of NADþsynthesis and salvage pathways Na, nicotinic acid (Niacin or vitamin B3); NADþ, b-NAM ... a maximal cell size had not been reached Accordingly, Amon and coworkers (Goranov et al, 2009) have shown that Saccharomyces cerevisiae cells can reach a cell volume as big as 800 fl We conclude
Ngày tải lên: 02/11/2022, 08:56
Gas sorption properties and kinetics of porous bismuth-based metal-organic frameworks and the selective CO2 and SF6 sorption on a new bismuth trimesate-based structure UU-200
... platinum-attenuated total reflectance (ATR) accessory Gas sorption experiments were carried out on a Micromeritics ASAP 2020 surface area analyzer (Norcross, GA, USA) and all samples were degassed ... carboxylate groups in a chelating mode to each one Bi3+ion while the remaining carboxylate chelate to one Bi3+and forms an additional bond to one additional Bi3+ The remaining two BTC3− anions ... of available N2 surface area on the Bi-MOF (given that any thermal expansion of the frameworks has a negligible effect on the diffusion of SF6) For example, CAU-33 had a lower N2 surface area
Ngày tải lên: 20/12/2022, 22:16
ON a NEW INVARIANT OF FINITELY GENERATED
... Trang 1arXiv:1003.3972v1 [math.AC] 21 Mar 2010On a new invariant of finitely generated modules over local rings Nguyen Tu Cuong∗, Doan Trung Cuong† and Hoang Le Truong‡ Institute of Mathematics ... polynomial is −∞ Corollary 3.6 M is a sequentially Cohen-Macaulay module (respectively, sequentially generalized Cohen-Macaulay module) if and only if there is a filtration F satisfying the dimension ... relate pF(M) with other known invariants of M In the present paper we have not yes had a general answer to this question When the filtration is the dimension filtration of M, i e., a filtration
Ngày tải lên: 23/12/2022, 09:02
radar tracking system using contextual information on a neural network architecture in air combat maneuvering
... maneuvering estimation from noisy position data from radar data are very scanty A detailed literature survey has been carried out by Ananthasayanam et al [21] and Amoozegar [22] Different tracking ... principal one being the reduction of mathe-matical and computational complexities As a case of application it is proposed to consider and augment contextual information with a common case of ... solution is applied to a typical air combat maneuvering, a dogfight, a form of aerial combat between fighter aircraft Advantages of integrating contextual information in a neural network tracking approach
Ngày tải lên: 24/12/2022, 14:02
Assignment on digital marketing geek squad a new business for a new environment
... diagnoses issues in and repairs all consumer electronics, as well as appliances Geek Squad has adequate resources to continue operations The firm has created a large base of consumers and can ... PURCHASING PATTERNS OF (A) ALL CONSUMERS AND (B) WOMEN MADE THE ACQUISITION OF GEEK SQUAD PARTICULARLY IMPORTANT FOR BEST BUY? C QUESTION 3: BASED ON THE CASE INFORMATION AND WHAT YOU KNOW ABOUT ... SQUAD PARTICULARLY IMPORTANT FOR BEST BUY Trang 7a All consumersThe purchasing patterns change as new and more complicated technology products became available First, consumers would be excited about
Ngày tải lên: 06/02/2023, 07:10
NEW BUSINESS IDEAS ARE THOUGHT ABOUT EVERY SINGLE DAY- DO YOU HAVE A NEW BUSINESS IDEA? potx
... (identify any resources used in preparation of business plan) 13 Appendix (general background data, research data, additional financial data, marketing materials, etc.) 2013 FIRST NATIONAL BANK BUSINESS ... • Promotional activities • Media Financial Analysis • Cash flow information • Balance sheet • Projected plan • Narrative about growth Summary Bibliography/Appendix Overall Appearance Conciseness ... plan to a panel of judges at First National Bank • All presentations will be given on Thursday, April 25, 2013 The time and location of the presentations will be determined by First National Bank
Ngày tải lên: 15/03/2014, 20:20
Case handling: a new paradigm for business process support pot
... which activities are enabled on the basis of the information available rather than theactivities already executed, • separate work distribution from authorization and allow for additional types ... complex case defini- Since case handling is a data-driven approach, activity definitions are associated with data ject definitions In particular, each activity definition is associated with at least one ... basic assumption driving most workflow management systems is a strict separationbetween data and process Only the control data is managed The strict separation between casedata and process control
Ngày tải lên: 15/03/2014, 21:20
Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx
... PLA5G2 (F) CGGTAAGCCCATAACGCCCA PLA3G2 (R) CAGGCCAGGATTTGCAGCC PLA3G4 (R) CATAAACAYGAGCCAGTTGCC AtxBF b (F) GCCTGCTCGAATTCGGGATG AtxBrcb(R) CTCCTTCTTGCACAAAAAGTG AtxACFc(F) CTGCTCGAATTCGGGATG AtxACrc ... CCCTATAGTGAGTCGTATTA T7 Promoter (R) CAGGAAACAGCTATGAC PLA5G (F) CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG PLA3G (R) CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG PLA5G1 (F) AGGAYTCTCTGGATAGTGG PLA3G1 (R) CTCACCACAGACGATWTCC ... contained a TAA stop codon, an AATAAA polyadenylation site 80 bp downstream from the stop codon, and a TATA-like box (CATAAAA) 270 bp upstream from the ATG translation initiation codon, as found
Ngày tải lên: 17/03/2014, 03:20
a new economy the changing role of innovation and information technology ppt
... au hpon, ont contaibuờ 3 ralentie la eisance dans eetains pays Laccờlờation dela eoissance ep Astral ax Danemark aus Etats-Unis en klaade, en Norvege et aux Pays-Basot wast pas un phờomtve parementcyhgue, ... lỏ ram = que Daneman Pongal Page Ba Espagne Poyaune Un ante Belge cans False Masque È Aten” ki =—=— Nowte Zande ‘uses Pear Horan Papubique eres “tou unt sourtamaya wg a alana Raia canner ... plus grande mabiiờ intemationale des ressources humaines, lee pays daivent aust porter atention au niveau national, ờdueation, a Tờlờvation des qualifications 13 la gestion des wssoures humains
Ngày tải lên: 18/03/2014, 11:22
Báo cáo Y học: A new high affinity binding site for suppressor of cytokine signaling-3 on the erythropoietin receptor potx
... Fujita, T., Kanakura, Y., Komiya, S & Yoshimura, A (1997) A new protein containing an SH2 domain that inhibits JAK kinases Nature 387, 921–924. 7 Naka, T , Narazaki, M., Hirata, M., Matsumoto, ... 5¢-GACCGGCGGCGAGGCGAACGCGCTGCTC AGTGCCGAGCCCG-3¢ (L58A s), 5¢-CGGGCTCGGC ACTGAGCAGCGCGTTCGCCTCGCCGCCGGTC-3¢ (L58A as), 85¢-CAGTCTGGGACCAAGAACGCGCGC ATCCAGTGTGAGGGG-3¢ (L93A s), 5¢-CCCCTCACA CTGGATGCGCGCGTTCTTGGTCCCAGACTG-3¢ ... structural classes Proc Natl Acad Sci USA 95, 114–119. 9 Masuhara, M., Sakamoto, H., Matsumoto, A., Suzuki, R., Yasukawa, H., Mitsui, K., Wakioka, T., Tanimura, S., Sasaki, A., Misawa, H., Yokouchi,
Ngày tải lên: 24/03/2014, 00:21
ACCESSIBLE INFORMATION EXCHANGE: MEETING ON A LEVEL PLAYING FIELD pot
... Braille If the aids and services are provided only after a request from a participant, also plan any invitation response deadlines to accommodate these time constraints As soon as a participant ... disabilities can Arranging an Accessible Meeting Space approach it and turn around easily to move away again Place handouts at the front edge of the table to make them easier to reach for participants ... everyone (e.g., have everyone sit at a head table with a tabletop microphone) or provide the speaker who has a disability with a hand-held or lavaliere microphone to allow her to speak from a position
Ngày tải lên: 29/03/2014, 18:20
Helping Older Adults Search for Health Information Online A Toolkit for Trainers from the National Institute on Aging potx
... If possible, arrange to have one or more classroom assistants work with students individually during the lesson. • Speak slowly and repeat information as often as necessary Don’t make assumptions based on students’ age ... Older Adults Search for Health Information Online: A Toolkit for Trainers from the National Institute on Aging Trang 26Helping Older Adults Search for Health Information Online: A Toolkit for Trainers ... compare the usefulness of the site map to the search box on the NIA home page What are the advantages and disadvantages of each? Make a list on the board or flip chart as points are raised Let students know that in future lessons you will be showing them even more ways
Ngày tải lên: 29/03/2014, 19:20
17% of cell phone owners do most of their online browsing on their phone, rather than a computer or other device pdf
... elaborate on their answers, and did not ask respondents to provide additional reasons for their usage patterns Trang 10Main reasons for going online mostly using cell phone 17% of adult cell phone ... Three-quarters of these cell phone internet users (74%) say that they go online using their phone on a typical day1—meaning that on a typical day fully 41% of all cell owners are using their phones ... their phones for one or both of these reasons Because 88% of U.S adults now own a cell phone, that works out to 49% of all U.S adults who go online using a cell phone at least occasionally Three-quarters
Ngày tải lên: 29/03/2014, 20:20
Báo cáo Y học: Human sprouty 4, a new ras antagonist on 5q31, interacts with the dual specificity kinase TESK1 potx
... amino acids The 2.5-kb cDNA represented an aberrant transcript without any substantial open reading frame The longest transcript (7 kb) harbors five polyadenylation sites (two AATAAA, and three AATTAAA), ... was recruited to the plasma membrane as part of lipid rafts upon cellular activation by VEGF, also casting doubt as to whether spry1 would exert its activity at the plasma membrane via contact ... Nakielny, S., Cohen, P & Marshall, C.J (1992) Activation of the MAP Kinase pathway by the protein kinase raf Cell 71, 335–442. 20 Ishizaki, T., Naito, M., Fujisawa, K., Maekawa, M., Watanabe,
Ngày tải lên: 31/03/2014, 15:20
Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments
... it; 4. Information Access and Management: Information access and management is an area of great activity, given the rise in popularity of the Internet and the explosion of data available to ... retrieved information can be updated automatically as often as necessary; 3. Information Enabled Applications: Hoover offers so-called " ;information enabled applications" which "accelerate ... 'non-problem'. Preamble 2. Information mapping is done by gathering (meta- )information about information and documents that are available on the Internet. This is a very time-consuming method that...
Ngày tải lên: 08/10/2012, 15:22