basic contents of a written contract of employment

Tài liệu Báo cáo khoa học: "The Utility of a Graphical Representation of Discourse Structure in Spoken Dialogue Systems" ppt

Tài liệu Báo cáo khoa học: "The Utility of a Graphical Representation of Discourse Structure in Spoken Dialogue Systems" ppt

... Spoken Dialogue Performance Analy- sis. In Proc. of EMNLP. M. Walker, D. Litman, C. Kamm and A. Abella. 2000. Towards Developing General Models of Usability with PARADISE. Natural Language Engineering. ... tutoring task. In addition, the SIH is not always available and users have to activate it manually. Other visual improvements for dialogue-based computer tutors have been explored in the past (e.g. ... and C. L. Sidner. 1998. COLLAGEN: A Col- laboration Manager for Software Interface Agents. User Modeling and User-Adapted Interaction, 8(3-4). M. Rotaru and D. Litman. 2006. Exploiting Discourse...

Ngày tải lên: 20/02/2014, 12:20

8 519 0
Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt

Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt

... three sets of primers: first set, A5 1 (5¢- GATGTCACGCAGAGTGAGCAGGTAG-3¢)/TRHR-7 (5¢-GAGACCATACAGAAC-C-3¢); second set, A5 2 (5¢- AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8 (5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢); ... (5¢-ATAATGGATAA CGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TC TGTTAAATGTACCTAAGTAGGCA-3¢)andTRHR2-2 sense (5¢-CAGCAAAATGGAAAATAGTAGC-3¢)/ TRHR2-4 antisense (5¢-CGACACTGTAGTAG-AGAT CACC-3¢), respectively. The PCR products ... with MERLIN software (LSR, Cambridge UK) to a monochro- mator (Spectramaster) and a 12/14 bit frame transfert rate digital camera (Astrocam). MERLIN software was also used to calculate the 340/380...

Ngày tải lên: 21/02/2014, 03:20

11 510 0
Báo cáo khoa học: Structural evidence of a-aminoacylated lipoproteins of Staphylococcus aureus pot

Báo cáo khoa học: Structural evidence of a-aminoacylated lipoproteins of Staphylococcus aureus pot

... Luel Lee 2 and Hiroshi Nakayama 1 1 Biomolecular Characterization Team, RIKEN Advanced Science Institute, Saitama, Japan 2 National Research Laboratory of Defense Proteins, Pusan National University, ... acyl–enzyme intermediate. Biochemistry 49, 341–346. 3 Fukuda A, Matsuyama S, Hara T, Nakayama J, Nagasawa H & Tokuda H (2002) Aminoacylation of the N-terminal cysteine is essential for Lol-dependent release of ... (2005) Depletion of apolipoprotein N-acyltransferase causes mislocalization of outer membrane lipoproteins in Escherichia coli. J Biol Chem 280, 974–983. 32 Kodama K, Fukuzawa S, Nakayama H, Kigawa T, Sakamoto...

Ngày tải lên: 06/03/2014, 01:20

13 411 0
The Impact of a Corporate Culture of Sustainability on Corporate Behavior and Performance pptx

The Impact of a Corporate Culture of Sustainability on Corporate Behavior and Performance pptx

... dependent variable is the percentage of stakeholder engagement mechanisms in Panel A that a firm has adopted. ―High Sustainability‖ is an indicator variable that takes the value of one if a firm ... the SAM Corporate Sustainability Assessment is supplemented with a Media and Stakeholder Analysis (MSA). The Media and Stakeholder Analysis allows SAM to identify and assess issues that may represent ... the dependent variable is the percentage of governance mechanisms in Panel A that a firm has adopted. ―High Sustainability‖ is an indicator variable that takes the value of one if a firm is included...

Ngày tải lên: 06/03/2014, 20:21

57 452 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

... to allow one missed cleavage per peptide, a mass tolerance of 0.5 Da, and for carbamido-methylation of cysteines to be considered as a fixed modification and oxidation of methio- nines as a variable ... Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against multidrug-resistant nosocomial bacterial strains. Antimicrob Agents Chemother ... the membrane of E. coli at their minimal antimicrobial concentrations, but rather traverse it, accumulate intracellularly, and damage a variety of essential vital processes to mediate the lethal event,...

Ngày tải lên: 16/03/2014, 00:20

18 495 0
Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt

Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt

... Goethe-Universita ¨ t Frankfurt, Germany; 3 Department of Physical Organic Chemistry and 4 Department of Chemical Research, Altana Pharma AG, Konstanz, Germany; 5 Max Planck Institut fu ¨ r Biophysikalische ... calibration of the intensities of the NOE peaks, a statistical analysis of the d aN (i,i+3) signals of residues 11–30 was performed using typical values for an ideal a- helix [13]. The a- helical structure ... peak integration unreliable. So, instead, signal height of the cross-peaks was used for a conservative estimation of the maximum distances and classification of cross-peaks as weak, medium and strong....

Ngày tải lên: 16/03/2014, 16:20

10 426 0
Confronting Images: Questioning the Ends of a Certain History of Art

Confronting Images: Questioning the Ends of a Certain History of Art

... adaptation of the grand ‘‘magic words’’ of Vasarian academicism: triumphant ri- nascita ` recast in a certain notion of the history of art as rationalist humanism; the famous imitazione recast in a hierarchical ... clear that this appeal to the work of Freud concerns precisely the putting in play of a critical paradigm—and absolutely not the putting in play of a clinical paradigm. In particular, the fate allotted the ... was known primarily through a dramatic adaptation in Yiddish by Shalom Ansky (1863–1920), the author of tales and novellas and a remarkable ethnologist of Jewish folklore in Poland and Russia. 6 The...

Ngày tải lên: 18/03/2014, 09:15

337 428 0
Báo cáo khoa học: Identification, characterization and activation mechanism of a tyrosine kinase of Bacillus anthracis docx

Báo cáo khoa học: Identification, characterization and activation mechanism of a tyrosine kinase of Bacillus anthracis docx

... the theoretical curve that was globally calculated by nonlinear least-squares fits of the data provided by BIAEVALUATION 3.1 software (Bia- core). (B) Titration curve of McsB with McsA. The titration of ... as Walker A, A and B, with some exceptions [4]. The majority of the bacterial tyrosine kinases possess a transmembrane domain and an intracellular catalytic domain [3,4]. These two domains are ... protein kinases. Curr Opin Struct Biol 16 , 702–709. 26 Mattoo AR, Zaman MS, Dubey GP, Arora A, Narayan A, Jailkhani N, Rathore K, Maiti S & Singh Y (2008) Spo0B of Bacillus anthracis – a protein...

Ngày tải lên: 23/03/2014, 06:20

11 408 0
Báo cáo khoa học: Characterization and structural modeling of a new type of thermostable esterase from Thermotoga maritima ppt

Báo cáo khoa học: Characterization and structural modeling of a new type of thermostable esterase from Thermotoga maritima ppt

... 5¢-GT GCTGGGACAC GCCCTCGGTGCGATGC-3¢ and 5¢-GC ATCGCACCGAG GGCGTGTCCCAGCAC-3¢,5¢-GATCT TCGGCGGCAGA AACTACCAGGTGACTG-3¢ and 5¢-CA Fig. 4. Alignment of the esterase lipase ⁄ pentapeptide motif of EstD ... 2837 GTCACCTGGTAGTTACTGCCGCCGAAG-3¢,5¢-CGAC GATCTCAAT AACTTGATGATTTCAGG-3¢ and 5¢-CTC CTGAAATCATCAA GTTATTGAGATCGTCG-3¢, respec- tively (the underlining indicates the modified codon). Muta- tions were confirmed ... Hirooka K, Shimanuki S, Yokota Y, Hemmi H, Nakayama T & Nishino T (2004) Molecular cloning and characterization of a thermo- stable carboxylesterase from an archaeon, Sulfolobus shibatae DSM5389:...

Ngày tải lên: 23/03/2014, 09:20

11 467 0
Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx

Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx

... GGCAACGAGCAAGGTCCGAAG sapE–R 2590 R GACGTCGTGAGTGCCTCCGTG mopB–F 3103 F CGACGTGCAGTATTACTTTTCTAGGG mopB–R 3103 R AGTATCAAACCGTGCTGGTCTCC Heme protein identification in M. capsulatus O. A. Karlsen ... CCP-similar core. A similarity search against the translated GenBank nucleotide database (tBLASTn) revealed significant similarity between MCA2590 and an unannotated ORF of Methylomicrobium album ... NY. 33 Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W & Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res...

Ngày tải lên: 23/03/2014, 11:20

12 398 0
Báo cáo khoa học: and protein bilinear indices – novel bio-macromolecular descriptors for protein research: I. Predicting protein stability effects of a complete set of alanine substitutions in the Arc repressor ppt

Báo cáo khoa học: and protein bilinear indices – novel bio-macromolecular descriptors for protein research: I. Predicting protein stability effects of a complete set of alanine substitutions in the Arc repressor ppt

... then calculates the invariants of the associated matrices. For example, Randic ´ and Basak used the principal eigenvalues from matrices as invariants in an analysis of the similarity degree among ... kth amino acid-bilinear indices are calculated by summing the kth amino acid bilinear indices of all amino acids of the same amino Table 4. Values of nonstochastic and stochastic total bilinear ... C a atom, that is to say ‘amino acid labels’) of the vertices of G m , as a result of the fact that components of the molecular vectors are values of some amino acid property that characterizes each...

Ngày tải lên: 29/03/2014, 09:20

29 407 0
Báo cáo khoa học: In vitro selection and characterization of a stable subdomain of phosphoribosylanthranilate isomerase potx

Báo cáo khoa học: In vitro selection and characterization of a stable subdomain of phosphoribosylanthranilate isomerase potx

... epitope and a truncated (ba) 8 -barrel. Clone Epitope sequence (5¢fi3¢) FLAG epitope GAC TAC AAG GAT GAC GAT GAT AAG DYKDDDDK Library template (FLAG-negative) TTG GGG CTG GAT GAC GCG GAT AAG L GLDDADK Randomization ... Billerica, MA, USA) and degassed before use. Assays were carried out at 25.0 °C. Sensorgrams were analyzed using the biaevaluation version 3.1 software package (Biacore AB). The software’s model ... proteins carrying a functional FLAG epitope from an excess of FLAG-negative com- petitors and from a large library of random variants was also undertaken by plasmid display, to confirm the efficacy of...

Ngày tải lên: 30/03/2014, 20:20

14 383 0
Báo cáo Y học: Solution structure of a hydrophobic analogue of the winter flounder antifreeze protein doc

Báo cáo Y học: Solution structure of a hydrophobic analogue of the winter flounder antifreeze protein doc

... structure determination), as no significant chemical shift changes were Table 1. Sequence alignment of TTTT and VVVV2KE. 1 2 13 24 35 TTTT D TASDAAAAAAL TAANAKAAAEL TAANAAAAAAA TAR VVVV2KE D VASDAKAAAEL VAANAKAAAEL ... carbonyl oxygen of Ala14 was hydrogen bonded to the amide proton of Ala17 instead. A straight helix around Lys18 was obtained in test calculations, and a short distance restraint was artificially introduced ... display and analysis of macromolecular structures. J. Mol. Graphics 14, 29–32. 31. Johnson, M.L., Correia, J.J., Yphantis, D .A. & Halvorson, H.R. (1981) Analysis of data from the analytical...

Ngày tải lên: 31/03/2014, 21:21

8 337 0
Cách sử dụng A lot of, lots of, plenty of, a large amount of, a great deal of docx

Cách sử dụng A lot of, lots of, plenty of, a large amount of, a great deal of docx

... of time. * Plenty of shops accept credit cards. A large amount of, a great deal of , a large number of Cách diễn đạt này mang tính tương đối trang trọng. Sau A large amount ofa great ... * A lot of my friends live abroad. * Lots of time is needed to learn a language. Plenty of Plenty of mang ngh a : “đủ và nhiều hơn n a , theo sau đó là danh từ không đếm được và danh ... great deal of là danh từ không đếm được. Ví dụ: * She has spent a great deal of time in Europe. Sau A large number of là trước danh từ số nhiều, và động từ theo sau nó cũng chia theo chủ...

Ngày tải lên: 02/04/2014, 13:20

6 1,7K 11
báo cáo hóa học: " Validation of a Chinese version of disease specific quality of life scale (HFS-36) for hemifacial spasm in Taiwan" docx

báo cáo hóa học: " Validation of a Chinese version of disease specific quality of life scale (HFS-36) for hemifacial spasm in Taiwan" docx

... recognized as a result of compression of the facial nerve at the root exit zone by an anatomical or pathological structure. Though not life threatening, patients with HFS may complain of social embarrassment and ... purposes) Introduction Hemifacial spasm (HFS) is characterized by involuntary contractions of the facial muscles innervated by the ipsi- lateral facial nerve, usually without any identifiable etiol- ogy. It has been ... treatment [1,2]. The treatment out- comes include relief of facial contractions and satisfaction with various aspects of their life quality. Health-related quality of life (HRQoL) is an important...

Ngày tải lên: 18/06/2014, 19:20

8 601 0
w