... how all members of the team participate and engage in the scenario training Simulation is widely used [12] in medical training particularly in hospital operating room anaesthesia training or teaching ... training It is of importance to participate and act in a realistic manner, use gloves, use stretchers in the same was as in a real-patient situation Involving other members of staff and using ... real equipment in the scenario is important for keeping participants in the zone as well as for maintaining a high degree of realism in the scenarios Bredmose et al Scandinavian Journal of Trauma,...
Ngày tải lên: 13/08/2014, 23:21
... (DOE) and the National Renewable Energy Laboratory (NREL) called ADVISOR (Advanced Vehicle Simulator), which was later acquired by AVL Powertrain Engineering, Inc ADVISOR is a software based on MATLAB/ Simulink ... This Chapter will describe the software modeling in detail, and provide validation results of the MATLAB/ ADAMS model against the ADVISOR simulation data 4.1 MATLAB/ Simulink Model The powertrain components ... simulation results obtained from the MATLAB/ ADAMS simulation platform and ADVISOR will be presented Chapter will contain comparative analysis of hybrid and conventional vehicle simulation based...
Ngày tải lên: 27/01/2016, 13:02
Báo cáo khoa học: "A Latent Topic Extracting Method based on Events in a Document and its Application" pot
... Computational Linguistics:294–301 Anastasios Tombros and Mark Sanderson 1998 Advantages of query biased summaries in information retrieval In Proceedings of the 21st Annual International ACM-SIGIR ... Summarization. (in Japanese) ohmsha Manabu Okumura and Hajime Mochizuki 2000 QueryBiased Summarization Based on Lexical Chaining Computational Intelligence,16(4):578–585 Qin Bing, Liu Ting, Zhang Yu, and ... Research on Multi-Document Summarization Based on Latent Semantic Indexing Journal of Harbin Institute of Technology,12(1):91–94 35 Rachit Arora and Balaraman Ravindran 2008 Latent dirichlet allocation...
Ngày tải lên: 23/03/2014, 16:20
Báo cáo khoa học: "Combining POMDPs trained with User Simulations and Rule-based Dialogue Management in a Spoken Dialogue System" docx
... mines the where au,t+1 is the true user action Rule -based Dialogue Management A rule -based dialogue manager was developed as a meaningful comparison to the trained DM, to obtain training data ... Higashinaka, M Nakano, and K Aikawa 2003 Corpus -based discourse understanding in spoken dialogue systems In ACL-03, Sapporo, Japan Visualization Tool E Levin, R Pieraccini, and W Eckert 2000 A stochastic ... online learning because data is available for querying as soon as it has been stored There is no need for separate logging mechanisms Multiple systems/applications are available on the same infrastructure...
Ngày tải lên: 23/03/2014, 17:20
Báo cáo sinh học: " The simultaneous presence and expression of human hepatitis C virus (HCV), human herpesvirus-6 (HHV-6), and human immunodeficiency virus-1 (HIV-1) in a single human T-cell" docx
... U16-17R gac act cca cca tag atc act c cat gat gca cgc tct acg aga c ctg tga gga act act gtc ttc acg cag cac tcg caa cca ccc tat cag cca gcn cac aaa ggn ata gga gg acb acy gcn cct tch cct ttc ccc aat ... cells are liver macrophages and Hepatocytes are liver endothelial cells 2B-cells priate primer set (Table 2) A band of about 400 bp was seen after PCR analysis, indicating HHV- 6A was replicating in ... of HIV1 and HCV in the same cell may greatly aggravate the malady Our TEM analysis showed HHV- 6A and HCV in the same cells, with extracellular HIV-1 particles budding or adjacent to the infected...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx
... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học:" Validation of the Rasch-based Depression Screening in a large scale German general population sample" doc
... data acquisition CN contributed to the analysis and interpretation of the data SG have been involved in drafting and revising the manuscript, and coordinated the study and data acquisition All ... a face to face interview The sample was intended to be representative in terms of age, gender and education Inclusion criteria were age at or above 14 years and German language skills (read and ... Unidimensionality and local independence To evaluate unidimensionality and local independence the residual correlation matrix was examined A principal component factor analysis of the residuals (PCFAR)...
Ngày tải lên: 20/06/2014, 16:20
Báo cáo hóa học: " Research Article Fixed Point Methods for the Generalized Stability of Functional Equations in a Single Variable" ppt
... 43–52, Karl-Franzens-Univ Graz, Graz, Austria, 2004 21 L C˘ dariu and V Radu, A Hyers-Ulam-Rassias stability theorem for a quartic functional equation,” a Automation Computers and Applied Mathematics, ... M Rassias, “On approximation of approximately linear mappings by linear mappings,” Journal of Functional Analysis, vol 46, no 1, pp 126–130, 1982 J M Rassias, “Solution of a problem of Ulam,” ... transformations,” Bulletin of the American Mathematical Society, vol 57, pp 223–237, 1951 Z Gajda, “On stability of additive mappings,” International Journal of Mathematics and Mathematical Sciences, vol...
Ngày tải lên: 22/06/2014, 06:20
Báo cáo sinh học: "Effect of including major gene information in mass selection: a stochastic simulation in a small population" ppt
... whatever the effect of the gene, a recessive favourable allele was easier to select than an additive one, itself easier to select than a dominant one: if A is dominant, AB animals are eliminated ... gain was obtained on the QTLs This polygenic lag was recovered in the case of a rare recessive favourable allele (fig 2a) but not in the situation of a rare dominant A allele (fig 2b) The values ... except for a favourable A allele rare and recessive where, as explained before, including the major gene information meant avoiding the risk of losing the favourable allele In this situation, the...
Ngày tải lên: 09/08/2014, 18:22
Báo cáo y học: "Rapid CD4 decline after interruption of non-nucleoside reverse transcriptase inhibitor-based antiretroviral therapy in a resource-limited setting" ppt
... statistical analysis, and drafting the manuscript SK participated in clinical assessment of patients and drafting the manuscript AA participated in drafting the manuscript KM participated in ... HIV-infected patients: the INCAS trial Italy, The Netherlands, Canada and Australia study JAMA 1998, 279(12):930-937 Manosuthi W, Chottanapand S, Thongyen S, Chaovavanich A, Sungkanuparph S: Survival rate ... in clinical assessment of study patients SW participated in clinical assessment of patients and drafting the manuscript BS participated in clinical assessment of patients and drafting the manuscript...
Ngày tải lên: 10/08/2014, 05:20
báo cáo khoa học: "Triple malignancy in a single patient including a cervical carcinoma, a basal cell carcinoma of the skin and a neuroendocrine carcinoma from an unknown primary site: A case report and review of the literature" ppt
... al.: Triple malignancy in a single patient including a cervical carcinoma, a basal cell carcinoma of the skin and a neuroendocrine carcinoma from an unknown primary site: A case report and review ... reported a case of four malignancies in the same patient including a cervical carcinoma and a basal cell carcinoma but in a metachronous setting [6] Human papilloma virus (HPV) infection has a wellestablished ... the analysis of the data HE approved the treatment and analyzed the literature data All authors read and approved the final manuscript Competing interests The authors declare that they have no...
Ngày tải lên: 10/08/2014, 23:20
Báo cáo y học: " The DAOA/G30 locus and affective disorders: haplotype based association study in a polydiagnostic approach" ppt
... contributed the data-analysis, interpretation of the data and drafting of the manuscript, GS initiated and coordinated the study All authors read and approved the final manuscript Page of 10 11 12 ... L, Barry C, Tanaka H, La Rosa P, Puech A, Tahri N, Cohen-Akenine A, Delabrosse S, Lissarrague S, Picard FP, Maurice K, Essioux L, Millasseau P, Grel P, Debailleul V, Simon AM, Caterina D, Dufaure ... bipolar disorder had reported various positive single marker and haplotype associations in European populations, only partially overlapping with the findings of a recent study on Asian populations...
Ngày tải lên: 11/08/2014, 16:22
Báo cáo y học: " Assessing the efficacy of a modified assertive community-based treatment programme in a developing country" potx
... structures and stressed that intensive care with small caseloads, may not be realistic in the South African setting [16] It is against this backdrop that the state psychiatric management team in the ... services in South Africa are based in primary health care institutions and have to contend with a lack of resources, particularly services offering residential specialized care In many cases these services ... but had the advantage that a single investigator (UB) performed all the assessments To be included as HFUs participants had to fulfill the full criteria as described in Additional file 2: Table...
Ngày tải lên: 11/08/2014, 16:22
Báo cáo y học: "The leading causes of death after burn injury in a single pediatric burn cente" docx
... on findings at autopsy, aspiration or asphyxia, or asthma attack ARDS was clinically defined by meeting four criteria: acute onset; bilateral fluffy pulmonary infiltrates by x-ray; pulmonary artery ... pneumonia, and also demonstrated pathological evidence of DAD The one patient that died of an acute asthma attack also had ARDS, but it was the asthma attack that was the fatal event Respiratory ... TBSA burn Inhalation injury was present in 20% of all admitted burns Figure Brain deaths Brain injury accounted for 16% of all deaths Anoxic brain injury accounted for 48% of the brain deaths after...
Ngày tải lên: 13/08/2014, 20:21
Feature based product modelling in a collaborative environment
... conversion into machining features using feature information, nominal geometry, and feature interaction; and lastly, the feasibility of the extracting machining features is analyzed Likewise, Li et al ... constraints, including distance constraints and angle constraints, are defined and solved The geometric constraints can be related by algebraic constraints for defining certain high-level parameters ... modeling has been widely used in product design and manufacturing A feature contains a parametric shape and the associated attributes that are used in downstream application processes, thus a feature...
Ngày tải lên: 11/09/2015, 10:01
Cell based diabetes treatment in a preclinical model
... diabetic monkeys that underwent liver resection and hepatocyte transplantation 50 ix ABBREVIATIONS AAALAC Association for Assessment and Accreditation of Laboratory Animal Care ALT Alanine aminotransferase ... bilirubin, alkaline phosphatase, serum alanine transaminase (ALT) and γ-glutamyl transferase (γGT) activities), renal function (urea and creatinine) and full blood counts (total and differential ... administered by injections, but recently an inhaled form has been developed Exubera, an inhaled product, was approved by the Food and Drug Administration (FDA) and was made available in USA in...
Ngày tải lên: 03/10/2015, 11:36
Managing disruptions in a refinery supply chain using agent based technique
... support approach for managing abnormal situations in supply chains The proposed approach involves an agent -based disruption management system and a separate supply chain simulation The main challenges ... supply chain It may also arise due to human or computational errors Disruption in finance flow: Finance plays a vital role in running an enterprise The unavailability of finance in a supply chain entity ... from all the activities in a supply chain vi is a measured variable and a ia a fraction which describes its affect on the KPI A variable is active in an activity in a KPI only if a ia ≠ for that...
Ngày tải lên: 10/11/2015, 11:42
Báo cáo khoa học: " Estimation of Paratuberculosis Prevalence in Dairy Cattle in a Province of Korea using an Enzyme-linked Immunosorbent Assay: Application of Bayesian Approach" ppt
... predictive values when covariate information is available and gold standard diagnosis is unavailable Stat Med 1996, 15(5), 463-476 Faraone, S V and Tsuang, M T Measuring diagnostic accuracy in the absence ... Estimation of Paratuberculosis Prevalence in Dairy Cattle in a Province of Korea using an Enzyme-linked Immunosorbent Assay: Application of Bayesian Approach 53 the binomial distribution in terms ... X M and Iyengar, S Bayesian inference on prevalence using a missing-data approach with simulation -based techniques: application to HIV screening Stat Med 1996, 15(20), 2161-2176 25 Milner, A R.,...
Ngày tải lên: 07/08/2014, 17:22
Bạn có muốn tìm thêm với từ khóa: