name value pairs in a single cookie

An integrated multi−period planning of the production and transportation of multiple petroleum products in a single pipeline system

An integrated multi−period planning of the production and transportation of multiple petroleum products in a single pipeline system

... available at GrowingScience International Journal of Industrial Engineering Computations   petroleum products in a single pipeline system Alberto Herrán a* , Fantahun M Defersha b , Mingyuan ... levels at refinery tanks it is necessary to define some binary variables: (a) a binary variable zu i,t,r,p with a value of 1 if the pumping of slug i in period t ends after beginning the loading ... in the last decade Existing approaches can be summarized in two groups attending to two fundamental criteria: (a) the type of pipeline system considered (a single pipeline system, or a pipeline

Ngày tải lên: 14/05/2020, 21:40

26 48 0
Characterization of genetic aberrations in a single case of metastatic thymic adenocarcinoma

Characterization of genetic aberrations in a single case of metastatic thymic adenocarcinoma

... thymic carcinomas and adenocarcinoma a Somatic mutations that are recurrent between thymic adenocarcinoma and 32 carcinomas analyzed by exome and targeted gene sequencing b Frequencies of arm-level ... SCNAs curated from array CGH reports of 35 carcinomas are compared with SCNAs in thymic adenocarcinoma, which are detected by Varscan2-CBS (red and green) and EXCAVATOR (gray) Trang 10In addition, ... chr16q, and chr17p) were recurrent (>15%) in thymic carcinomas and adenocarcinoma (Fig 6b) The focal MYC amplification was remarkable in thymic adenocarcinoma while thymic carcinomas showed broad

Ngày tải lên: 06/08/2020, 07:47

12 17 0
CULTURAL-VALUE-DIMENSIONS-IN-A-STRATEGIC-DECISION-MAKING-CONTEXT

CULTURAL-VALUE-DIMENSIONS-IN-A-STRATEGIC-DECISION-MAKING-CONTEXT

... cultures As a result of these findings, CVDs, or value orientations, are conceptualized as being universal in that they have meaning across cultures, albeit with varying levels of salience in each ... dimensions as a set provides depth of understanding that is often unavailable in studies focussing upon a single cultural value dimension The CVDs interact and behavior is a result of that interaction ... within an international context Placing CVDs in a Business Context The goal is to contextualize the CVDs in order to measure their effect upon decision making in a firm Traditional organizational

Ngày tải lên: 20/10/2022, 07:48

14 10 0
Luận văn clinical characteristics of 54 medical staff with covid 19 a retrospective study in a single center in wuhan china j med virol 2020

Luận văn clinical characteristics of 54 medical staff with covid 19 a retrospective study in a single center in wuhan china j med virol 2020

... the infection status of medical personnel is still lacking A total of 54 cases of SARS‐Cov‐2 infected medical staff from Tongji Hospital between 7 January and 11 February 2020 were analyzed in ... suggest training for all hospital staff to prevent infection and preparation of sufficient protection and disinfection materials KEYW OR DS COVID‐19 patients, medical staff, nucleic acid‐negative, ... "Ρпeum0пia Diaǥп0sis aпd Tгeaƚmeпƚ Ρг0ƚ0ເ0l f0г п0ѵel ເ0г0пaѵiгus (SAГS ເ0г0пaѵiгus 2 [SAГS‐ເ0ѵ‐2]) iпfeເƚed ρпeum0пia (ƚгial ѵeгsi0п 5)."4 Eρidemi0l0ǥiເal, ເliпiເal, aпd maпaǥemeпƚ daƚa aгe 0ьƚaiпed

Ngày tải lên: 18/07/2023, 19:46

13 1 0
Báo cáo khoa học: A single intersubunit salt bridge affects oligomerization and catalytic activity in a bacterial quinone reductase pptx

Báo cáo khoa học: A single intersubunit salt bridge affects oligomerization and catalytic activity in a bacterial quinone reductase pptx

... variants adopting a tetrameric assem-bly Interestingly, all protein variants show a drastically reduced quinone reductase activity in steady-state kinetics Detailed analysis of the two half reactions ... free FMN and are summarized inTable1 The native molecular mass was estimated by mole-cular sieve chromatography Each protein variant eluted as a single species; however, all protein variants exhibited ... Trang 1and catalytic activity in a bacterial quinone reductaseAlexandra Binter1, Nicole Staunig2, Ilian Jelesarov3, Karl Lohner4, Bruce A Palfey5, Sigrid Deller1, Karl Gruber2and Peter Macheroux1

Ngày tải lên: 30/03/2014, 01:20

12 409 0
Báo cáo khoa học: A single mutation in Escherichia coli ribonuclease II inactivates the enzyme without affecting RNA binding pot

Báo cáo khoa học: A single mutation in Escherichia coli ribonuclease II inactivates the enzyme without affecting RNA binding pot

... demonstrate that the single amino acid sub-stitution Asp209fiAsn in RNase II is able to cause the total inactivation of the enzyme without affecting its RNA binding capability In addition, metal ions ... Trang 1inactivates the enzyme without affecting RNA bindingMo´nica Amblar and Cecı´lia M Arraiano Instituto de Tecnologia Quı´mica e Biolo´gica ⁄ Universidade Nova de Lisboa, Oeiras, Portugal ... The balance between mRNA synthesis and decay is an important aspect of gene expression in all organisms The RNases are involved in many functions such as RNA processing, stability and degradation,

Ngày tải lên: 30/03/2014, 15:20

12 321 0
Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx

Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx

... Kappa 2 GGTGATATCWTGMTGACCCAAWCTCCACTCTC Kappa 3 GGTGATATCGTKCTCACYCARTCTCCAGCAAT C region kappa primer TGGTGGGAAGATGGA Signal sequence/framework primers Gamma 1 GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG ... Trang 1Open AccessResearch Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide Jianmin Chen, Sanat K Davé and Anthony ... protected against HSV-2 by topical administration of antibody [33,34] and a subsequent report from Zeitlin et al [35] that mice were protected against HSV-2 transmission by intravaginal administra-tion

Ngày tải lên: 18/06/2014, 22:20

10 541 0
báo cáo hóa học: " Boosting with intranasal dendrimeric Aβ1–15 but not Aβ1–15 peptide leads to an effective immune response following a single injection of Aβ1–40/42 in APP-tg mice" ppt

báo cáo hóa học: " Boosting with intranasal dendrimeric Aβ1–15 but not Aβ1–15 peptide leads to an effective immune response following a single injection of Aβ1–40/42 in APP-tg mice" ppt

... demonstrated that non-B cell mechanisms may also have a role in clear- ing cerebral Aβ [8]. A multi-center Aβ vaccine human clin- ical trial (AN1792) was initiated but was suspended when approximately ... processed, and embedded in paraffin. The other hemi-brain was snap fro- zen and stored at -80°C for biochemical analysis of Aβ. Anti-A β antibody ELISA Anti-Aβ antibodies in plasma were measured ... (using antibodies kindly supplied byELAN Pharmaceuticals) as previously described [36]. Statistical analysis Kruskal-Wallis nonparametric one-way ANOVA analysis was used to determine statistical

Ngày tải lên: 19/06/2014, 22:20

10 399 0
báo cáo hóa học: " Single-step processing of copper-doped titania nanomaterials in a flame aerosol reactor" ppt

báo cáo hóa học: " Single-step processing of copper-doped titania nanomaterials in a flame aerosol reactor" ppt

... containing the liquid TTIP precursor was placed in an oil bath and was maintained at a temperature of 98°C The precursor delivery tube was maintained at a temperature of 210°C by a heating tape ... Trang 1nanomaterials in a flame aerosol reactorManoranjan Sahu and Pratim Biswas* Abstract Synthesis and characterization of long wavelength visible-light absorption Cu-doped TiO2nanomaterials ... oxidation state of 3+ or lower when placed in the titania lattice points create a charge-com-pensating anion vacancy [36] and cause a transformation to the rutile phase as also found in this study At

Ngày tải lên: 21/06/2014, 02:20

14 407 0
báo cáo hóa học: " An initial-boundary value problem for the one-dimensional non-classical heat equation in a slab" potx

báo cáo hóa học: " An initial-boundary value problem for the one-dimensional non-classical heat equation in a slab" potx

... Trang 1R E S E A R C H Open AccessAn initial-boundary value problem for the one-dimensional non-classical heat equation in a slab Natalia Nieves Salva1,2, Domingo Alberto Tarzia1,3*and Luis Tadeo ... behavior for the solution for particular choices of the heat source, initial, and boundary data are also obtained A generalization for non-classical moving boundary problems for the heat equation ... Volterra integral formulation for problems (1.1) to (1.4) In Section 3, 4 and 5, boundedness, comparisons results and asymptotic behavior regarding particular initial and boundary data are obtained

Ngày tải lên: 21/06/2014, 02:20

17 520 0
Báo cáo hóa học: "MAXIMUM PRINCIPLES FOR A CLASS OF NONLINEAR SECOND-ORDER ELLIPTIC BOUNDARY VALUE PROBLEMS IN DIVERGENCE FORM CRISTIAN ENACHE " pptx

Báo cáo hóa học: "MAXIMUM PRINCIPLES FOR A CLASS OF NONLINEAR SECOND-ORDER ELLIPTIC BOUNDARY VALUE PROBLEMS IN DIVERGENCE FORM CRISTIAN ENACHE " pptx

... must occur at a critical point ofu, if Ω is a convex domain inRN Suppose thatΦ(x,a,b) takes its maximum value at P on ∂Ω Then, by Hopf’s second maximum principle [4,8], we must haveΦ≡cte inΩ or ∂Φ/∂n ... have the same meaning as above Next, using the differential equation (1.1) in the equivalent form Δu = − h f g − g  and inserting (2.4), (2.6), (2.7), and (2.8) in (2.2), we obtain after some ... Trang 1SECOND-ORDER ELLIPTIC BOUNDARY VALUEPROBLEMS IN DIVERGENCE FORM CRISTIAN ENACHE Received 22 January 2006; Accepted 26 March 2006 For a class of nonlinear elliptic boundary value problems

Ngày tải lên: 22/06/2014, 22:20

13 333 0
Growth and value in a volatile world pptx

Growth and value in a volatile world pptx

... stakeholders and spread the brand name quickly in a lucrative market In contrast, one bank’s late arrival in Latin America resulted in a failed attempt to establish a dominant presence in a market ... Trang 9Balancing global capabilities and local opportunities A sensible strategy for globalisation today means far more than building cheaply in one location and selling in another What has changed ... to R&D and innovation capacities in their companies as patent expirations and low R&D productivity are leaving many large pharmaceuticals with uncertain revenue streams Pharmaceuticals

Ngày tải lên: 28/06/2014, 17:20

40 398 0
Báo cáo y học: "Diagnostic value of anti-topoisomerase I antibodies in a large monocentric cohort" pdf

Báo cáo y học: "Diagnostic value of anti-topoisomerase I antibodies in a large monocentric cohort" pdf

... established in clinical laboratory practice dur-ing past years, allowdur-ing examination of a large number of sera in a rapid approach at high sensitivity and at high specificity [7-10] anti-topo I: anti-topoisomerase ... man-ufacturer's recommendation Statistical analysis The dataset was analysed using the SPSS V 15.0 statistical package (NASDAQ, Bloomingdale, IL 60108, USA) and the Microsoft calculation software ... anti-human IgG Control sera were included in each assay Incubated blot strips were digitalized using a flatbed scanner The intensity of the bands was auto-matically evaluated by a computer program

Ngày tải lên: 09/08/2014, 01:22

10 636 0
Báo cáo khoa học: "A single centre experience with sequential and concomitant chemoradiotherapy in locally advanced stage IV tonsillar cancer" doc

Báo cáo khoa học: "A single centre experience with sequential and concomitant chemoradiotherapy in locally advanced stage IV tonsillar cancer" doc

... preparation and approval; DCO: Data analysis, interpretation, manuscript approval; DW: Data collection, analysis, manuscript approval; KED: Original Concept, Manuscript approval; CC: Original ... pre-hydration and 2 litres post-hydration with normal saline during an over-night inpatient stay Carboplatin (area under curve 4) was substituted for cisplatin if creatinine clearance was <55 ml/min calculated ... benefit in locally advanced HNSCC [21-23] Although induction chemotherapy has only a minimal survival benefit of 2% in a large meta-analysis, the combination of cisplatin and 5-FU was associated

Ngày tải lên: 09/08/2014, 09:20

10 364 0
Báo cáo khoa học: " Intensity modulated radiotherapy (IMRT) in the treatment of children and Adolescents - a single institution''''s experience and a review of the literature" pps

Báo cáo khoa học: " Intensity modulated radiotherapy (IMRT) in the treatment of children and Adolescents - a single institution''''s experience and a review of the literature" pps

... Laskar S, Bahl G, Muckaden M, Pai SK, Gupta T, Banavali S, Arora B, Sharma D, Kurkure PA, Ramadwar M, Viswanathan S, Rangarajan V, Qureshi S, Deshpande DD, Shrivastava SK, Dinshaw KA: Nasopha-ryngeal ... for Intensity Modulated Radiation Therapy (IMRT) in Pediatric Population Technol Cancer Res Treat 2006, 5:591-596. 24. Penagaricano JA, Papanikolaou N, Yan Y, Ratanatharathorn V: Appli-cation ... medical aspects of treatment planning and application, idea for this paper, literature research and proof reading All authors read and approved the final manuscript Acknowledgements The work was

Ngày tải lên: 09/08/2014, 10:20

10 527 0
Báo cáo y học: "Vaccination response to tetanus toxoid and 23-valent pneumococcal vaccines following administration of a single dose of abatacept: a randomized, open-label, parallel group study in healthy subjects" pot

Báo cáo y học: "Vaccination response to tetanus toxoid and 23-valent pneumococcal vaccines following administration of a single dose of abatacept: a randomized, open-label, parallel group study in healthy subjects" pot

... weeks after abatacept) The apparent decrease in vaccination response in subjects in Group B can-not be accurately evaluated because of the higher baseline values obtained in these subjects While abatacept ... (%)) Table 2 Abatacept serum concentration levels determined 14 and 28 days after vaccination Group Baseline (μg/ml) 14 days after vaccination (μg/ml) 28 days after vaccination (μg/ml) Data presented ... Declaration of Helsinki and was approved by Insti-tutional Review Boards All subjects gave informed consent Drug administration and vaccination Abatacept 750 mg was administered over 30 minutes

Ngày tải lên: 09/08/2014, 10:20

11 417 0
Báo cáo sinh học: " The value of using probabilities of gene origin to measure genetic variability in a population" doc

Báo cáo sinh học: " The value of using probabilities of gene origin to measure genetic variability in a population" doc

... randomly sampled at any autosomal locus of a given animal has a 0.5 probability of originating from its sire, and a 0.5 probability of originating from its dam Similarly, it has a 0.25 probability ... selected at random among 50 candidates of each sex and mated at random Before analysis, pedigree informa-tion (sire and dam) was deleted with a probability pfor males and p for females In all situations, ... virtually meaningless It should be noted that Ne was slightly less overestimated in the case where both the paternal and maternal sides were affected by a lack of information at the same rate than

Ngày tải lên: 09/08/2014, 18:22

19 410 0
Báo cáo y học: "Direct cord implantation in brachial plexus avulsions: revised technique using a single stage combined anterior (first) posterior (second) approach and end-to-side side-to-side grafting neurorrhaphy" pot

Báo cáo y học: "Direct cord implantation in brachial plexus avulsions: revised technique using a single stage combined anterior (first) posterior (second) approach and end-to-side side-to-side grafting neurorrhaphy" pot

... accurate than magnetic resonance imaging in evaluating root avulsions [12], patients accepted mag-netic resonance imaging more readily Magmag-netic reso-nance imaging was reported to have a 81% ... 0 to a score of 4 Pain In adult total avulsions (Cases 1 and 2), pain persisted and had a grade of 4 In C5,6 ruptures C7,8T1 avulsions, pain disappeared, but patients complained of a sensation ... radioopaque marker hemo-clips and inserted carefully into the paraspinal muscles toward the anterior suprascapular region Several days later, and through an anterior supraclaviclar approach, the

Ngày tải lên: 10/08/2014, 10:20

17 425 0
Báo cáo y học: "IMP321 (sLAG-3), an immunopotentiator for T cell responses against a HBsAg antigen in healthy adults: a single blind randomised controlled phase I study" ppt

Báo cáo y học: "IMP321 (sLAG-3), an immunopotentiator for T cell responses against a HBsAg antigen in healthy adults: a single blind randomised controlled phase I study" ppt

... Trang 1and VaccinesOpen Access Original research IMP321 (sLAG-3), an immunopotentiator for T cell responses against a HBsAg antigen in healthy adults: a single blind randomised controlled phase ... supporting the use of this recombinant protein as a promising candidate adju-vant for cancer vaccination In the present study, we report on the clinical and biolog-ical effects, and safety evaluation ... IMP321, a GMP-grade sLAG-3 (hLAG-3Ig) protein, in a large randomised single blind phase I clinical trial The results of this proof-of-con-cept clinical study in healthy volunteers using HBsAg as a

Ngày tải lên: 11/08/2014, 10:23

15 331 0
báo cáo khoa học: "Parthenocarpic potential in Capsicum annuum L. is enhanced by carpelloid structures and controlled by a single recessive gene" docx

báo cáo khoa học: "Parthenocarpic potential in Capsicum annuum L. is enhanced by carpelloid structures and controlled by a single recessive gene" docx

... lesion in the AUXIN RESPONSIVE FACTOR 8 (ARF8) gene [3] Expression of an aberrant form of Ara-bidopsis ARF8 also conferred parthenocarpy in Arabi-dopsis and tomato, indicating ARF8 as an important ... a single integument, indicating that the ovule is uniteg-mic in nature This integument gradually grows to cover the nucellus leaving a micropylar opening Typical for an anatropous ovule, at anthesis ... more carpelloid structures Parthenocarpic potential inC annuum is not caused by a mutation inCaARF8 Similar to tomato and Arabidopsis, a mutation in the ARF8gene might lead to the parthenocarpic

Ngày tải lên: 11/08/2014, 11:21

15 376 0
w