... correlates poorly with liver histology, the ratio of aspartate aminotransferase (AST) to alanine aminotransferase (ALT) >1 is a dependable marker for cirrhosis [28,29] Increased INR and thrombocytopenia ... regardless of treatment candidacy Alcohol abstinence should be recommended to all patients as this may accelerate the progression of liver disease Hepatotoxic drugs should also be avoided, as patients ... Am J Gastroenterol 1998;93(1):44-8 29 Giannini E, Risso D, Botta F, et al Validity and clinical utility of the aspartate aminotransferase-alanine aminotransferase ratio in assessing disease severity...
Ngày tải lên: 02/11/2012, 09:51
... {ACC) ( ACC ACT) {ACC ACT) {ACC ACT STA) (ACH ACT ACC ( ACC ACT) ) (STA ACC ACT ACH) (A C T ACC) (ACC) (ACC) (STA ACC ACT ACH) ~STA ACC ACT ACH) (ACC ACT) Figure 9: Aspectual Classification Results ... figure to determine 263 Aspectual Category(s) (ACC) (ACC ACT) (ACC ACT) (ACC) ~ACC ACT) (STA A C C A C T ACH) (STA A C C A C T A C H ) (ACC ACT STA) (ACC) (ACC) ~ACC ACT) ~ACC) ~ACC) (ACC ACT) {ACC) ... is an acceptable translation for (7)0) However, the same is not true of (7)(it): (9) (i) (it) Juan le dio pufialadaa a Maria Juan le dio una pufialada a Maria Juan h a b f a i d o a la tienda...
Ngày tải lên: 17/03/2014, 08:20
Báo cáo khoa học: "A Lazy Way to Chart-Parse with Categorial Grammars" ppt
... guarantee that a parser will always make available, say in a chart, the constituent that could have combined under The rules of combinatory eategorial grammar are purely declarative, and unification ... (such as Y) was a constituent under the previous analysis Nor of course can we afford a standard breadth-fast strategy Karttunen (198 6a) has pointed out that a parser which associates a canonical ... round brackets to def'me sets, and we notate features as [label value] We refer to variables with symbols starting with capital letters, and to labels and constants with symbols starting with lower-case...
Ngày tải lên: 17/03/2014, 20:20
A Unique Guide to Business potx
... want something you must plan ahead Be it a wealthy significant other or an advantage in business Bill Gates didn't become as rich as he is today without foresight, carefully planning ahead and ... so they too can one day own a deluxe apartment Chapter 1: Plan for Tomorrow Today So you've decided to read this book Well congratulations because today you are going to learn about the principles ... what exactly does all this mean you ask? Well even though you don't want to know I am still going to tell you Affordability means that a Gold Digger has to know what she can afford and this can...
Ngày tải lên: 24/03/2014, 00:20
josef bigun - vision with direction. a systematic introduction to image processing and computer vision
... that are sensed and translated to multidimensional signals These travel along the visual pathways forward and backward, in parallel and serially, thanks to a fascinating chain of chemical and ... provide inputs to layers and 3, whereas cells in layers and project to layers and Layers and also provide inputs to adjacent cortical areas Cells in layer provide inputs to adjacent cortical areas ... frequently qualified as a relay station between the retina and visual cortex, and its cells are also called relay cells The outputs from LGN cells form a wide band called optic radiations and travel to...
Ngày tải lên: 05/06/2014, 11:59
báo cáo hóa học:" Psychometric evaluation of the Osteoporosis Patient Treatment Satisfaction Questionnaire (OPSAT-Q™), a novel measure to assess satisfaction with bisphosphonate treatment in postmenopausal women" potx
... therapy (HRT), calcitonin and the human recombinant parathyroid hormone active fragment (teraparatide) As is the case with many classes of chronically administered drugs, non-compliance with osteoporosis ... conceptually related scales are substantially correlated with each other (r > 0.40) Reliability Internal consistency reliability (Cronbach's alpha) was calculated for each of the OPSAT-Q scales ... in the same hypothesized scale are substantially correlated with each other (r > 0.40) [14] Subscale to subscale correlations were also evaluated The validity of scales are substantiated when...
Ngày tải lên: 20/06/2014, 15:20
báo cáo khoa học: "A simple technique to position patients with bilateral above-knee amputations for operative fixation of " docx
... Injury 1997, 28:570 Rethnam U, Yesupalan RS, Sohaib A, Ratnam TK: Hip fracture fixation in a patient with below-knee amputation presents a surgical dilemma: a case report J Med Case Rep 2008, 2:296 ... article as: Aqil et al.: A simple technique to position patients with bilateral above-knee amputations for operative fixation of intertrochanteric fractures of the femur: a case report Journal ... References Parker M, Johansen A: Hip fracture: clinical review BMJ 2006, 333:27-30 Parker MJ, Handoll HHG: Extramedullary fixation implants and external fixators for extracapsular hip fractures in adults...
Ngày tải lên: 11/08/2014, 02:22
A fast method to segment images with additive intensity value
... images, β and α should be set to a smaller value to give less weight to the length and curvature regularization Also if the intensity are not exactly additive, the value of γ can be lowered to give ... model and some of its results in Chapter In Chapter 2, we give details of the v CONTENTS adaptation of the augmented Lagrangian method to solve the soft additive model and also the lagged curvature ... λm1 and λm2 are Lagrange multipliers and rp1 , rp2 , rn1 , rn2 , rm1 and rm2 are positive penalty parameters It is known that one of the saddle points of the augmented Lagrangian functional gives...
Ngày tải lên: 16/09/2015, 12:35
Báo cáo hóa học: "A Probabilistic Model for Face Transformation with Application to Person Identification" pot
... suggests that we should separate Gaussian parameters into face-dependent (FD) parameters, that is, parameters that depend on a particular query image, and face-independent transformation (FIT) parameters, ... we provide a set of pairs of pictures Each pair contains a template and a query image that belong to the same person We now provide formulas for reestimating the Gaussian parameters and transition ... variation between images of human faces, is much smaller than the dimensionality of a single face considered as an arbitrary 2D image As a useful approximation, one may consider an individual...
Ngày tải lên: 23/06/2014, 01:20
A simple introduction to working with LVM
... hda1, hda2, and hda3 are all physical volumes We'll initialize hda3 as a physical volume: root@lappy:~# pvcreate /dev/hda3 If you wanted to combine several disks, or partitions you could the same ... that we have a volume group (called skx-vol) we can actually start using it Working with logical volumes What we really want to is create logical volumes which we can mount and actually use In ... uh7umg-7DqT-G2Ve-nNSX-03rs-KzFA-4fEwPX LV Write Access LV Status # open LV Size Current LE Segments Allocation Read ahead sectors Block device read/write available 2.00 GB 512 inherit 254:0 The important thing to realise...
Ngày tải lên: 18/09/2012, 10:12
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents
... as we have seen it also has syntactic implications 2.2.2 Gradable and non- gradable adjectives According to L G Alexander (1988, 108) adjectives can be also divided into gradable and non- gradable ... time available/ in the available time.(1) We have to exploit all available potential/ all potential available in our country (2) As we know that when changing the position of adjective available ... connection with health such as a faint chance, a faint hope _ Predicative adjectives beginning with aThe following adjectives are used only predicatively like afloat, afraid, alight, alike, alone, ashamed,...
Ngày tải lên: 10/04/2013, 14:46
A Sneaky Backdoor In to Google FAST With Free Press Releases!
... to make advanced, hand-crafted soaps Based on years of research Dave doesn't leave the reader hanging "Learning how to make soap is not brain surgery" Cushion explains "That's why I wrote Soap ... originally wanted to make the main keyword “Soap Making” instead of “Soap Making Secrets” because soap making had over 22,000 searches the previous month… But I left it alone and wanted to see what ... makers Dave even shows all the tricks world-class soap makers rely on to make their best soaps He also provides invaluable links to organizations, books and the best places online to get additional...
Ngày tải lên: 23/10/2013, 01:15
Tài liệu A Practical Guide to Business Continuity & Disaster Recovery with VMware Infrastructure docx
... virtual hardware resources, as well as an operating system and all its applications, inside a software package Encapsulation makes virtual machines incredibly portable and easy to manage, and VMware ... from an operational failback Capacity Management Capacity management was a concern; for example, what happens if an operational load is moved to a second site with its own operational load? Network ... of physical memory allocated each virtual machine as application loads increase and decrease • Networking VMware virtualization platforms provide access to physical network adapters and also offer...
Ngày tải lên: 18/02/2014, 00:20
Tài liệu Báo cáo khoa học: "A Composite Kernel to Extract Relations between Entities with both Flat and Structured Features" ppt
... Y and Maeda E 2003 Hierarchical Directed Acyclic Graph Kernel: Methods for Structured Natural Language Data ACL-2003 Zelenko D., Aone C and Richardella A 2003 Kernel Methods for Relation Extraction ... 2004 data shows consistent better performance on all setups than the 2003 data although the ACE 2003 data is two times larger than the ACE 2004 data This may be due to two reasons: 1) The ACE 2004 ... POS tagging, NE tagging, syntactic parsing, template extraction and relation extraction using a generative model Feature-based methods (Kambhatla, 2004; Zhou et al., 2005; Zhao and Grishman, 20052...
Ngày tải lên: 20/02/2014, 12:20
SIMPLE OPEN ECONOMY MACRO WITH COMPREHENSIVE ACCOUNTING A RADICAL ALTERNATIVE TO THE MUNDELL FLEMING MODEL ppt
... economies reach a quasi-stationary state in which all stocks and all flows including the stock of money not change at all – but there is a never ending purchase of Treasury Bills (and a growing stock ... that Mundell (1961) himself was aware that the automaticity of the rules of the game relied on a particular behaviour of the central bank Indeed he lamented over the fact that modern central banks ... rate of interest immediately raises the $ rate of exchange This disturbs the whole system by generating fiscal and trade imbalances The changing exchange rate eventually restores a steady state...
Ngày tải lên: 06/03/2014, 15:21
Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc
... ACTGGGTACCATGGCTCAGCGTTGCGGTGAC CAGGCTCGTGGTGCTAAATGCCCGAACTGCCTGTGCTGTG GTAAGTACGGCTTCTGCGGTTCTGGTGACGCTTACTGTGG CGCTGGTTCTTGCCAGTCTCAGTGCCGTGGTTGCTAGGGAT TTTAGCACCACGAGCCTGGTCACCGCAACGCTGAGC CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG ... CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG GACTGGCAAGAACCAGCGCCACAGTAAGCGTCACCA GCTAGGATCCCTAGCAACCACGGCAC Table Antifungal activity of WAMP- 1a IC50 is the concentration necessary for 50% growth inhibition Fig Expression and ... Escherichia coli and assays of recombinant WAMP 1a activity against diverse plant pathogens, such as chitin-containing and chitin-free fungi, and Grampositive and Gram-negative bacteria The amino acid...
Ngày tải lên: 07/03/2014, 02:20
Báo cáo khoa học: Unconventional translation initiation of human trypsinogen 4 at a CUG codon with an N-terminal leucine A possible means to regulate gene expression pdf
... necessarily mean that translation starts from a downstream AUG, as predicted by genome and mRNA analysis, but raises the possibility that the translated form may have used a CUG start codon with an ... from an 83-year-old man and a 71.0 g sample of occipital cortex from a 85-year-old man with a short (25 h) post mortem delay RNA isolation, reverse transcription and 5Â-RACE Total RNA was isolated ... with an N-terminal leucine amino acid Our present study indicates that nonAUG translation initiation may be operable more often than anticipated This may have a great impact on the analysis of genes...
Ngày tải lên: 07/03/2014, 10:20
Work Smart: Connect a Microsoft Account (Windows Live ID) to Your Domain Account pptx
... continue to sign in to your office computer with your domain (network) credentials If you access a website or service that normally requires a Windows Live ID for authentication, you won’t need to ... account or you can click Sign up for a new email address at the bottom of the screen to create a new email address Tap or click Next In the Help us protect your identity screen, enter the characters ... Microsoft Corporation All rights reserved Page of Work Smart: Connect a Microsoft Account (Windows Live ID) to Your Domain Account Get Started Note This dialog box may not appear depending on...
Ngày tải lên: 14/03/2014, 23:20