How to Help With Math Homework - When the Answers Aren’t in the Book (A Guide for Students, Families, & Friends) pot
... important mathematical ideas, connect mathematical concepts, ask questions that help students see things in new ways and provide the mathematical terminology that allows us to understand each other ... Beaudry and William Blatner Photos by William Blatner and Jackie Rigali How to Help With Math Homework When The Answers Aren’t in the Book Many math curricula, such as the Interactive Math Program ... with centimeter and inch scales Protractor Calculator: Minimally, every student should have a scientific calculator with trigonometric functions (sin, cos and tan) for use at home Graphing calculators...
Ngày tải lên: 31/03/2014, 12:20
A simple introduction to working with LVM
... hda1, hda2, and hda3 are all physical volumes We'll initialize hda3 as a physical volume: root@lappy:~# pvcreate /dev/hda3 If you wanted to combine several disks, or partitions you could the same ... that we have a volume group (called skx-vol) we can actually start using it Working with logical volumes What we really want to is create logical volumes which we can mount and actually use In ... might be useful to take a look at them with the pvdisplay command: root@lappy:~# pvdisplay - Physical volume PV Name /dev/hda3 VG Name skx-vol PV Size 28.88 GB / not usable Allocatable yes PE Size...
Ngày tải lên: 18/09/2012, 10:12
What To Do If Trapped In A Lift With A Dentist
... charge 10 THINGS YOU WOULDN'T WANT FOR CHRISTMAS A dead robin in a sock, a relaxation CD that appears to be voiced by Ian Paisley A pair of trainers pickled in bree A vague sense of inadequacy ... of the place Sellotape a photo of Hitler onto a beer mat and then smear his face with a gallon of pig fat Pretend you're using a laptop by folding some cardboard in half and writing a windows ... others history is a corpse leave it alone it teaches us nothing except how to repeat past mistakes again and again and again WAR War what is it good for? Reinvigorating depressed economies and winning...
Ngày tải lên: 14/11/2012, 16:50
Approaches to Establish a Modeling WWTP with a Case Study in Qinghe WWTP
... of mathematical models Mathematical Models to describe wastewater treatment process develop very fast these years The task group of IAWQ (International Association of Water Quality) first began ... conventional parameter apparatus such as temperature, pH and conductance etc., and water quality analysis apparatus such as NH4+-N, PO43—P and COD etc The instruments should be maintained regularly, ... WWTPs have their own data management systems, such as SCADA (Supervisor, Control and Data Acquisition) and control system with the function to pick up the analysis data and control the automatic...
Ngày tải lên: 05/09/2013, 09:08
Structural and semantic features of english idioms referring to head and a contrastive analysis with vietnamese idioms
... often have sandwiches, salads and meat or fish On Sundays, many families have a traditional meat at home: grilled meat with potatoes, vegetables and gravy For many English people, dinner is a main ... eaten at a certain time of a day But the contents of a meal and the ways of eating are different from one community to another In the past, Vietnamese farmers have two main meals (breakfast and ... Similarly, when we say “do not beat a dead horse” we not refer to a carcass of a certain kind of animal but what we mean is that a person should not waste time thinking of an issue that has already...
Ngày tải lên: 20/12/2013, 18:33
Tài liệu Updating a DataSet with a Many-to-Many Relationship ppt
... changes made to the DataSet with the data source Refresh Button.Click This event handler clears all data from the DataSet LoadData( ) is then called to load all data from the data source into ... each The LoadData( ) method is called to retrieve data for each table in the DataSet Finally, the default view for the parent and the child tables are bound to data grids on the form LoadData( ... SqlDbType.NVarChar, 50, FIELD3_FIELD); updateCommand.Parameters.Add(FIELD4_PARM, SqlDbType.NVarChar, 50, FIELD4_FIELD); daChild.UpdateCommand = updateCommand; // Create the ParentChild DataAdapter daParentChild...
Ngày tải lên: 26/01/2014, 10:20
Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different flanking bases preference pptx
... of a three-stranded antiparallel b-sheet and an a- helix, packed approximately parallel to the b-sheet, with the seven thoroughly conserved amino acids (Arg6, Arg8, Trp10, Glu16, Arg18, Arg26 and ... from amino acid sequence data Anal Biochem 182, 319–326 Liu Q, Kasuga M, Sakuma Y, Abe H, Setsuko M, Yamaguchi-Shinozaki K & Shinozaki K (1998) Two transcription factors, DREB1 and DREB2, with an ... poly.[d (A- T)].poly[dAdT] (Amersham Pharmacia Biotech) gradient of 0.001– 10 lg was added to a final volume of 10 lL of each aliquot After incubation for a further 10 min, the contents were loaded on to an 8%...
Ngày tải lên: 18/02/2014, 13:20
Breast cancer risk in relation to occupations with exposure to carcinogens and endocrine disruptors: a Canadian case–control study pptx
... (nonauto) Plastics manufacturing (auto) 26 Metal-related Metallurgical, metalworking, metal fabrication 64 75 Transportation Transportation 37 26 Cleaning/beauty care Beauty salon/hair care 25 ... large retail sector as reference (data not shown) That sector appeared to have less than average breast cancer risk (Tables 1, 3) and, as a result, all the estimates for other sectors increased considerably ... Luginaah I, Laukkanen E, Hellyer D, Reinhartz A, Watterson A, Abu-Zahra H, Maticka-Tyndale E, Schneider K, Beck M, Gilbertson M: Occupation and breast cancer: a Canadian case– control study Ann...
Ngày tải lên: 06/03/2014, 02:21
Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc
... mode An external calibration was performed using standard peptide solution Cal Mix1 and Cal Mix2 (Applied Biosystems) and an additional internal calibration was performed during mass spectra analysis ... build an inclusion list with the light and heavy precursor masses for cross-linked candidate peptides analysis NanoLC-LTQ-Orbitrap data were processed automatically as described as well as manually ... et al an accurate mass and time tag approach Mass Spectrom Rev 25, 450–482 Supporting information The following supplementary material is available: Fig S1 Analytical strategy for Ure2p–Ssa1p...
Ngày tải lên: 15/03/2014, 00:20
Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot
... GTTAGTAGGTGAGAAATCGGCGGTTCAGTTTAACAGCAACA TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC GAGAAATCGTGGGTTCAGGCCAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTGGCCTGAACCCACGATTTCTC TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA ... GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA TCTGCCCCTGGAGCCCTGCCCCA TGGGGCAGGGCTCCAGGGGCAGA CCTCGTCCTGCCGCCTCCAATGCTCTGGA TCCAGAGCATTGGAGGCGGCAGGACGAGG GCTCTGGAGCCTGACGCCAAGGCTCTGAGTATTGC GCAATACTCAGAGCCTTGGCGTCAGGCTCCAGAGC ... PCR (mutated nucleotides are in bold): 5¢-GTTGCTGTTAAACTGAACCGCCGAT-3¢ (Trp551 fi Ala), 5¢-GTTGCTGTTAGCCTGAACCCAC GAT-3¢ (Phe554 fi Ala), 5¢-GTTGCTTGCAAACTGAA CCCACGAT-3¢ (Asn555 fi Ala) and 5¢-GTTGCTGTTA...
Ngày tải lên: 16/03/2014, 12:20
Panorama: A Database System that Annotates Its Answers to Queries with their Properties potx
... real world value Thus, a null value is practically a declaration of the unsoundness of a particular data value The Closed World Assumption states that a database contains all the data that it attempts ... SYSTEM THAT ANNOTATES ITS ANSWERS 63 In addition, Panorama extends the query language with three statements to manipulate and query the meta-database To add a new property view to the meta-database, ... information in the database may suggest additional characterizations of the extensional answer If this intensional information is extracted, database values may gain additional meaning Thus, a database...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: "Robust Approach to Abbreviating Terms: A Discriminative Latent Variable Model with Global Information" docx
... forms as the training/evaluation data The evaluation metrics used in the abbreviation generation are exact-match accuracy (hereinafter accuracy), including top-1 accuracy, top-2 accuracy, and top-3 ... problem, as compared to the generation problem Eytan Adar 2004 SaRAD: A simple and robust abbreviation dictionary Bioinformatics, 20(4):527– 533 Hiroko Ao and Toshihisa Takagi 2005 ALICE: An algorithm ... (2003), SaRAD (Adar, 2004), ALICE (Ao and Takagi, 2005), Chang and Schă tzes u method (CS) (Chang and Schă tze, 2006), Nadeau u and Turney’s method (NT) (Nadeau and Turney, 2005), and Okazaki et al.’s...
Ngày tải lên: 17/03/2014, 01:20
Báo cáo khoa học: "A New String-to-Dependency Machine Translation Algorithm with a Target Dependency Language Model" pot
... the cat(Da red apple ) = LA(cat(Da ), LA(cat(Dred ), cat(Dapple ))) (b) Figure 6: Operations over well-formed structures = LA(LC(cat(Da ), cat(Dred )), cat(Dapple )) vantage of various translation ... Schwartz, L Micciulla, and J Makhoul 2006 A study of translation edit rate with targeted human annotation In Proceedings of Association for Machine Translation in the Americas W Wang, K Knight, and ... Michigan, June J Eisner and G Satta 1999 Efficient parsing for bilexical context-free grammars and head automaton grammars In Proceedings of the 37th Annual Meeting of the Association for Computational...
Ngày tải lên: 17/03/2014, 02:20
Learn To Build With PHP: A Crash Course
... is dizzyingly large It is the database behind WordPress and Facebook, and is based upon the reliable relational database paradigm Advantages of the MySQL database are too numerous to mention Firstly, ... Variables Variables are a concept found in virtually all programming languages They are used to store a value, which can be retrieved, used and changed later on You might be familiar with a ... where variables are declared with the ‘var’ keyword var x = 10; In PHP, however, variables are declared with a dollar symbol $x = 10; PHP variables cannot start with a number or a special character...
Ngày tải lên: 19/03/2014, 11:46