as b like c such as d for

Tài liệu Engineering Mechanics - StaticsChapter 1Problem 1-1 Represent each of the following combinations of units in the correct SI form using an appropriate prefix: (a) m/ms (b) μkm (c) ks/mg (d) km⋅ μN Units Used: μN = 10−6N kmμkm = 109−6Gs = 10 s pptx

Tài liệu Engineering Mechanics - StaticsChapter 1Problem 1-1 Represent each of the following combinations of units in the correct SI form using an appropriate prefix: (a) m/ms (b) μkm (c) ks/mg (d) km⋅ μN Units Used: μN = 10−6N kmμkm = 109−6Gs = 10 s pptx

... the direction θ of the third cable so that the magnitude of force F in this cable is a minimum All forces lie in the 36 © 2007 R C Hibbeler Published by Pearson Education, Inc., Upper Saddle ... magnitude and direction, measured counterclockwise from the positive x' axis, of the resultant force of the three forces acting on the bracket Given: F = 300 N 48 © 2007 R C Hibbeler Published by ... the publisher Engineering Mechanics - Statics Chapter Problem 2-27 The beam is to be hoisted using two chains Determine the magnitudes of forces FA and FB acting on each chain in order to develop...

Ngày tải lên: 17/02/2014, 14:20

1,1K 1,1K 2
Bác sĩ giải đáp về "chuyện ấy"

Bác sĩ giải đáp về "chuyện ấy"

... àưång àïën c quan àố 21 Chưìng: Thûa b c sơ Thïë nâo lâ kđch dc? Chng c vai trô gò àïí sinh hoẩt tònh dc àûú c tưët àểp? B c sơ: C c vng kđch thđch tònh dc (nhẩy c m tònh dc) bao gưìm c c b å phêån ... khỗi b rấch Nhiïìu c åp vúå chưìng tỷõ chửởi khửng duõng bao cao su, hoồ cho rựỗng chng lâm giẫm c m gi c Nhûú c àiïím ca bao cao su lâ dng chng lâm mêët t c dng tđch c c ca ho c mưn tònh dc tinh ... thđch c c vng kđch dc Mù c d c thïí tiïëp tc cho túái lc ngûúâi ph nûä trúã lẩi trẩng thấi b nh thûúâng Nïëu nhû àân ưng àẩt àûú cc khoấi trûú c thò phẫi tiïëp tc kđch thđch c c vng kđch dc cho...

Ngày tải lên: 15/01/2016, 02:07

99 286 3
Báo cáo toán học: " Inequalities for convex and s-convex functions on Delta=[a,b]x[c,d]" potx

Báo cáo toán học: " Inequalities for convex and s-convex functions on Delta=[a,b]x[c,d]" potx

... s c a+ b, c+ d b a b a d c d c ∂f ∂s q (y, s) c b − a c+ d (s − c) c d ∂f ∂s (s − d) c+ d c+ d b − a c c +d b a +b a +b d s s c , c+ d d c d c (s − d) ∂f ∂s a +b d s s c , c+ d ds d c d c a +b d s s c ... b a b a d c d c b t t−a d s s c a+ b, c+ d dt b a b a d c d c ∂f ∂s + (t − b) ∂f ∂s ∂f ∂s b t t−a d s s c a+ b, c+ d ds b a b a d c d c b t t−a d s s c a+ b, c+ d ds dt b a b a d c d c By calculating ... , c+ d ds d c d c (s − c) d + a t−a d s s c b t a+ b, c+ d dt ds b a b a d c d c ∂f ∂s = (b − a) + a +b t−a d s s c b t a+ b, c+ d dt ds b a b a d c d c d = (b − a) b t t−a d s s c a+ b, c+ d b a...

Ngày tải lên: 20/06/2014, 21:20

26 403 1
tóm tắt luận án cu based organic frameworks as catalysts for c c and c n coupling reactions (tiếng anh)

tóm tắt luận án cu based organic frameworks as catalysts for c c and c n coupling reactions (tiếng anh)

... Therefore, Cu-MOFs constructed from BDC, BTC or BPDC recently attracted great attention 1.1 1.2 Cu3 (BTC)2, Cu(BDC), Cu2 (BDC)2(DABCO) and Cu2 (BPDC)2 (BPY)  Cu3 (BTC)2 , Cu(BDC), Cu2 (BDC)2 (DABCO) ... CHAPTER CATALYTIC STUDIES OF Cu3 (BTC)2 , Cu2 (BDC)2 (DABCO), Cu2 (BPDC)2 (BPY), Cu(BDC) ON C C AND C N COUPLING REACTIONS 3.1 Introduction  Cu3 (BTC)2 , Cu2 (BDC)2 (DABCO), Cu2 (BPDC)2 (BPY) ... (DABCO), Cu2 (BPDC)2 (BPY) and Cu(BDC); ii)Catalytic studies of Cu3 (BTC)2 , Cu2 (BDC)2 (DABCO), Cu2 (BPDC)2 (BPY) on C C coupling reactions between amine compounds and terminal alkynes, catalytic...

Ngày tải lên: 18/06/2015, 17:07

28 343 0
Cu based organic frameworks as catalysts for c c and c n coupling reactions

Cu based organic frameworks as catalysts for c c and c n coupling reactions

... 1.2 Cu3(BTC)2, Cu(BDC), Cu2(BDC)2(DABCO) and Cu2(BPDC)2 (BPY) 1.2.1 Structures and properties of Cu3 (BTC)2, Cu(BDC), Cu2(BDC)2(DABCO) and Cu2(BPDC)2(BPY) Cu3(BTC)2 [46], Cu(BDC) [44], Cu2(BDC)2(DABCO) ... 1.2.3 Characterization of Cu3(BTC)2, Cu(BDC), Cu2 (BDC)2(DABCO) and Cu2(BPDC)2 (BPY) Cu3(BTC)2, Cu(BDC), Cu2(BDC)2(DABCO) and Cu2(BPDC)2(BPY) can be characterized by various techniques, such as < /b> ... (BTC)2, Cu(BDC), Cu2(BDC)2(DABCO) and Cu2(BPDC)2 (BPY), which are constructed from copper salts and 1,4-benzenedicarboxylic acid (BDC), 1,3,5-benzenetricarboxylic acid (BTC) and 4,4’-biphenyldicarboxylic...

Ngày tải lên: 10/01/2017, 16:33

175 385 0
A STUDY ON THE USE OF CLASSROOM DISCIPLINE AS MOTIVATION FOR SECOND LANGUAGE ACQUISITION IN THE CONTEXT OF ENGLISH LANGUAGE TEAC

A STUDY ON THE USE OF CLASSROOM DISCIPLINE AS MOTIVATION FOR SECOND LANGUAGE ACQUISITION IN THE CONTEXT OF ENGLISH LANGUAGE TEAC

... these codes of classroom discipline and their actual practicality Recommendations for other types of discipline codes are also sought after from both teachers and students by asking for suggested ... ways of a disrupting a class.’ Whether discipline and discipline problems are discussed either directly or indirectly, subjectively or objectively, it all boils down to a number of sub factors First, ... teacher or the other students and they can be difficult to deal with.’ Disruptive behavior is not confined to one age group Eleven-year-olds can become incredibly unruly and noisy, and adolescents...

Ngày tải lên: 07/09/2013, 13:06

41 889 12
Biodegradable Polymers as Scaffolds for Tissue Engineering

Biodegradable Polymers as Scaffolds for Tissue Engineering

... to bind calcium Upon embedding in the calcified matrix, osteoblasts become osteocytes As < /b> calcification proceeds, bony spicules radiate out from the region Osteoid matrix Calcified bone Bone cell ... mesenchymal cells differentiate into cartilage, and this cartilage is later replaced by bone The process by which a cartilage intermediate is formed and replaced by bone cells is called endochondral ... the cells to be seeded in scaffolds Scaffold type I is used for differentiated cells including fibroblast, osteoblast, and chondrocyte, as < /b> represented in Figure 14.3 Figure 14.4 demonstrates Scaffold...

Ngày tải lên: 25/10/2013, 08:20

22 458 0
Tài liệu Công Nghệ Thi Công Dầm Hộp Liên Tục B.T.C.T.D.Ư.L. Bằng Phương Pháp Đúc Hẫng ppt

Tài liệu Công Nghệ Thi Công Dầm Hộp Liên Tục B.T.C.T.D.Ư.L. Bằng Phương Pháp Đúc Hẫng ppt

... Tr- c b- c vào c ng vi c sử d ng xe đ c, Ban huy c ng tr-ờng phải tổ ch c cho c n b ,c ng nhân c ng tr-ờng nắm b t đ- c nguyên t c làm vi c xe đ c hẫng,từ an toàn viên c ng ty c c c h-íng d n ... th-ờng khối đ c d m hẫng c b c p phải c ng, chúng đ- c căng đồng thời đối xứng Nếu c chênh lệch áp l c đ- c phép chênh lệch c p Khi kích c ng c p b t đầu chịu l c, pa-lăng xích treo kích phải thả ... tr- c mặt c u 14 c ng nghệ thi c ng d m hộp btct d. -.l Hình 7: Mặt b n xe đ c 500 600 250 200 D n chủ Gông đuôi D m ray Sàn c ng t c Chân chạy phía tr- c Sàn c ng t c Thanh C C D3 8 K0 Sàn c ng...

Ngày tải lên: 20/01/2014, 23:20

44 1,1K 15
Tài liệu Báo cáo khoa học: a-Conotoxins as tools for the elucidation of structure and function of neuronal nicotinic acetylcholine receptor subtypes doc

Tài liệu Báo cáo khoa học: a-Conotoxins as tools for the elucidation of structure and function of neuronal nicotinic acetylcholine receptor subtypes doc

... GGCCSHPACAANNQDYC IRDcCCSNPACRVNNOHVC GID AnIB GCCSHPACAGNNQHIC GIC RDPCCSNPVCTVHNPQIC GCCSYPPCFATNPD -C AuIB (ribbon) PIA GCCSYPPCFATNPD -C [125I]MII AuIB [125I]YGCCSNPVCHLEHSNLC a-Conotoxin Table (Continued) ... provide a rational way to develop additional pharmacological tools for the elucidation of nAChR structure and function Sequencea GCCSDPRCAWR C ACCSDRRCRWR C GCCSLPPCAANNPDYC GCCSLPPCALNNPDYC GCCSLPPCAASNPDYC ... indicated, Ki values for inhibition of epibatidine binding are shown; B, inhibition of a-BTX binding d Indicates cases where Kd values were obtained from oocyte-expressed receptors GGCCSHPACAANNQDYC...

Ngày tải lên: 19/02/2014, 12:20

15 762 0
Tài liệu Báo cáo khoa học: Stem–loop oligonucleotides as tools for labelling double-stranded DNA pdf

Tài liệu Báo cáo khoa học: Stem–loop oligonucleotides as tools for labelling double-stranded DNA pdf

... CGGTCCTAGTTCGACGCTAGCTTTTTTTTCTCTTTCCTCCTTTTCTTTTCACGTGGAGCTACTAGG CGGTCCTAGTACTCGACGCTAGCTTTTTTTTCTCTTTCCTCCTTTTCTTTTCACGTGGAGCTGTACTAGG CGGTCCTAGTACGCTCGACGCTAGCAAAATTTTCTCTTTCCTCCTTTTCAAAACACGTGGAGCTGCGTACTAGG CGGTCCTAGTTCGACGCTAGCAAAAGTTTTGGTGGTTTGTGTTTTAAAACACGTGGAGCTACTAGG ... single-stranded sticky ends are shown in italics TFO Sequence TC4 TC6 TC8 TC10 TG6 TG8 TG10 TG11 CGGTCCTATTTCGACGCTAGCTTTTTTTTCTCTTTCCTCCTTTTCTTTTCACGTGGAGCTTCTAGG CGGTCCTAGTTCGACGCTAGCTTTTTTTTCTCTTTCCTCCTTTTCTTTTCACGTGGAGCTACTAGG ... CGGTCCTAGTTCGACGCTAGCAAAAGTTTTGGTGGTTTGTGTTTTAAAACACGTGGAGCTACTAGG CGGTCCTAGTACTCGACGCTAGCAAAAGTTTTGGTGGTTTGTGTTTTAAAACACGTGGAGCTGTACTAGG CGGTCCTAGTACGCTCGACGCTAGCAAAAGTTTTGGTGGTTTGTGTTTTAAAACACGTGGAGCTGCGTACTAGG CGGTCCTAGCTACGCTCGACGCTAGCAAAAGTTTTGGTGGTTTGTGTTTTAAAACACGTGGAGCTGCGTAGCTAGG...

Ngày tải lên: 20/02/2014, 03:20

10 374 0
Tài liệu Test of English as a Foreign Language doc

Tài liệu Test of English as a Foreign Language doc

... Policies" in the Bulletin FOLD FOLD If paying by credit card, enter credit card number (American Express, Discover, JCB, MasterCard, or VISA) M Credit Card Account Number M Y Y Expiration Date ... .University California (cont d) California (cont d) California (cont d) Colorado (cont d) 4094 CA Baptist C. , Riverside 9769 CA Board of Pharmacy, Sacramento 9319 CA Board of Registered Nursing, Sacramento ... the Bulletin for preferred forms of payment, payment policies, and acceptable currencies – Certified Check (enclosed) – UNESCO Coupons (enclosed) – Money Order – (enclosed) – Credit Card (Provide...

Ngày tải lên: 20/02/2014, 11:21

36 870 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

... and C http://www.nap.edu/catalog/12793.html ACRONYMS AND ABBREVIATIONS AASLD ACIP ACOG AHRQ AIDS ALT anti-HBc anti-HBs anti-HCV API AST AVHPC CDC CHIP CI CIA CMS DIS DTaP DUIT DVH EIA EIP EPSDT ... immunization, and catchup vaccination of unvaccinated children and adolescents—has resulted in a dramatic reduction in chronic HBV infection in infants and acute HBV infection in children of all ethnicities ... problems occurred with this vaccine in 2008 (adult and dialysis formulations of Recombivax HB) and 2009 (pediatric formulations of Recombivax HB and Pediatric Engerix -B) A shortage was avoided because...

Ngày tải lên: 06/03/2014, 01:20

191 458 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

... interval enhanced chemiluminescence Centers for Medicare and Medicaid Services DIS DTaP disease intervention specialist diptheria and tetanus toxoids and acellular pertussis adsorbed vaccine drug user ... Transmitted Disease, and Tuberculosis Prevention; HBV, hepatitis B virus; HCV, hepatitis C virus; HIV/AIDS, human immunodeficiency virus/acquired immunodeficiency syndrome SOURCES: aCDC, 200 9b; bCDC, ... of HCC cases because HBV and HCV are the leading causes of this type of cancer Key characteristics of hepatitis B and hepatitis C are summarized in Table 1-1 and discussed below and in later chapters...

Ngày tải lên: 06/03/2014, 01:20

253 374 0
Báo cáo khoa học: Homoadenosylcobalamins as probes for exploring the active sites of coenzyme B12-dependent diol dehydratase and ethanolamine ammonia-lyase docx

Báo cáo khoa học: Homoadenosylcobalamins as probes for exploring the active sites of coenzyme B12-dependent diol dehydratase and ethanolamine ammonia-lyase docx

... Japan) AdoMeCbl and AdoEtCbl were prepared as < /b> described before by Gschosser ă et al [25], and AdePeCbl as < /b> described by Hogenkamp [26] All other chemicals were reagent-grade commercial products and ... ammonia-lyase [44] and ribonucleotide reductase [29] and a weak competitive inhibitor for methylmalonyl-CoA mutase [44] 2¢-DeoxyAdoCbl is 31%, 17%, and 5–13% as < /b> active as < /b> AdoCbl for diol dehydratase ... Time courses of reactions with homoadenosylcobalamins as < /b> coenzymes Propionaldehyde and acetaldehyde formed by enzymatic reactions were assayed by the alcohol dehydrogenase-NADH coupled method, as...

Ngày tải lên: 07/03/2014, 21:20

10 449 0
w