annex 4 scope of work for phase ii data collect

iec 60079-4 method of test for ignition temperature

iec 60079-4 method of test for ignition temperature

... GAS ATMOSPHERES Part 4: Method of test for ignition temperature Scope This method of test is intended for use in the determination of the ignition temperature of a chemically pure vapour or gas ... accumulation of more information Data A record shall be kept of the name, source and physical properties of the combustible, test number, date of test, ambient temperature, pressure, quantity of sample ... clean flask shall be used for tests on each product and for the final series of tests Where the ignition temperature of the test sample exceeds the softening point of a borosilicate glass flask,...

Ngày tải lên: 25/12/2013, 10:36

28 441 1
Statement of Work for the Recovery Audit Program potx

Statement of Work for the Recovery Audit Program potx

... the assistance of provider associations to help collect this information and house it in an easily updatable database Paying for medical records a Recovery Auditors shall pay for medical records ... tracking of all communication and allows for easy access for customer service representatives This also allows for easy transmission to CMS in the event of an audit or when the listing for the ... considered underpayments for the purposes of the program Examples of an Underpayment: The provider billed for 15 minutes of therapy when the medical record clearly indicates 30 minutes of therapy was provided...

Ngày tải lên: 23/03/2014, 04:20

57 532 0
STANDARD STATEMENT OF WORK FOR FINANCIAL AUDITS OF COVERED PROVIDERS OBJECTIVES AND GENERAL STATEMENT OF WORK AUDIT OF MCC RESOURCES MANAGED _part1 pot

STANDARD STATEMENT OF WORK FOR FINANCIAL AUDITS OF COVERED PROVIDERS OBJECTIVES AND GENERAL STATEMENT OF WORK AUDIT OF MCC RESOURCES MANAGED _part1 pot

... statement of work for non U.S Covered Providers to use for financial audits required of them by the host country Accountable Entity Revised January 2006 This is trial version www.adultpdf.com of the ... auditors must perform additional audit steps of the technical assistance and services under this statement of work, unless (COVERED PROVIDER’s name) has separately contracted for an audit of these costs ... accept responsibility for the schedule's accuracy before the review commences C(1) Agreement with Life -of- Project Cost-Sharing Budget For an agreement with a life -of- project budget for cost-sharing...

Ngày tải lên: 19/06/2014, 22:20

11 347 0
STANDARD STATEMENT OF WORK FOR FINANCIAL AUDITS OF COVERED PROVIDERS OBJECTIVES AND GENERAL STATEMENT OF WORK AUDIT OF MCC RESOURCES MANAGED _part2 pot

STANDARD STATEMENT OF WORK FOR FINANCIAL AUDITS OF COVERED PROVIDERS OBJECTIVES AND GENERAL STATEMENT OF WORK AUDIT OF MCC RESOURCES MANAGED _part2 pot

... discussed with the responsible officers of (COVERED PROVIDER’s name) The MCC Inspector General is responsible for assuring that the work performed under this statement of work complies with U.S Government ... permanently excluded from performing additional audits of MCC-funded programs VIII TERMS OF PERFORMANCE The effective date of this contract will be the date of the signature of (COVERED PROVIDER’s ... coordinator for this contract is [name of person, telephone number and email address] The audit firm will work in coordination with [name and title of designated person within the office of the MCC...

Ngày tải lên: 19/06/2014, 22:20

10 295 0
Part 4: Code of practice for design of composite slabs with profiled steel sheeting ppt

Part 4: Code of practice for design of composite slabs with profiled steel sheeting ppt

... 4: Code of practice for design of composite slabs with profiled steel sheeting; — Part 5: Code of practice for design of cold formed sections; — Part 61): Code of practice for design of light ... depth of profiled steel sheets Ds Overall depth of composite slab ds Effective depth of slab to centroid of profiled steel sheets Modulus of elasticity of profiled steel sheets End anchorage force ... considered in the design of composite slabs a) Stage Profiled steel sheeting as formwork The assessment of commercially available shapes of profiled steel sheets, used as formwork to support wet concrete...

Ngày tải lên: 08/07/2014, 22:20

38 725 4
Tài liệu ime Control of a Three Phase 4 Wire PWM Inverter with Variable DC Link Voltage and Battery Storage for PV Application doc

Tài liệu ime Control of a Three Phase 4 Wire PWM Inverter with Variable DC Link Voltage and Battery Storage for PV Application doc

... symmetr of the outp voltage i achieved a the linea region of t PWM I the ry put is and ar the modulator o the DC/AC VSI (Volta Source I m of C age Inverter) is e extended Figure principle of the ... go of the sy oal ystem illustra ated in figure is to supply th as well as single ph i s hree hase loads of any art with constant am f h mplitude sinusoidal voltage and constant freq c quency For ... inverte er Since the po ower generat by an arr of PV pa ted ray anels is direc ct-current, it may be transformed, eith her into a power with consta voltage for dc applications or int ac power In both...

Ngày tải lên: 19/01/2014, 02:20

9 651 0
Báo cáo khoa học: "Long-term results from a randomized phase II trial of neoadjuvant combined-modality therapy for locally advanced rectal cancer" ppt

Báo cáo khoa học: "Long-term results from a randomized phase II trial of neoadjuvant combined-modality therapy for locally advanced rectal cancer" ppt

... acquisition of data, analysis and interpretation of data; involvement in drafting and reviewing the manuscript IO: contributions to acquisition of data FA: contributions to acquisition of data, analysis ... informed consent The trial was approved by the ethic committees of the Institute of Oncology, Ljubljana, Slovenia and of the Republic of Slovenia and was in agreement with the Declaration of ... devices were used to displace the small bowel out of the irradiated volume A multileaf collimator was used for shaping the fields and for the protection of normal tissues Chemotherapy with capecitabine...

Ngày tải lên: 09/08/2014, 09:20

8 290 0
Báo cáo khoa học: " Prospective phase II study of preoperative short-course radiotherapy for rectal cancer with twice daily fractions of 2.9 Gy to a total dose of 29 Gy - Long-term results" ppt

Báo cáo khoa học: " Prospective phase II study of preoperative short-course radiotherapy for rectal cancer with twice daily fractions of 2.9 Gy to a total dose of 29 Gy - Long-term results" ppt

... acquisition of data and data analysis, statistical analysis, writing and drafting of the manuscript JW: conception and design of the study, acquisition of data and data analysis AT: acquisition of data ... data and data analysis DW: acquisition of data and data analysis AT: conception and design of the study GM: acquisition of data MS: conception and design of the study Table 5: Calculation of biological ... Despite high rates of local control, about 25% of the patients suffered from systemic progression of disease resulting in DFS of 65% after five years This contrast of low rates of systemic control...

Ngày tải lên: 09/08/2014, 10:20

9 273 0
Synthesis of work exchange networks for gas processing applications 4

Synthesis of work exchange networks for gas processing applications 4

... movers, the aforementioned examples demonstrated the usefulness of such an approach by reducing the total cost of the network Moreover, it provides a general view of TAC of the network at different ... temperature of a stream are known constants     Figure 4.1 Multi-stage superstructure for each stream in WEN synthesis  70    Chapter Work Exchange Networks Synthesis 4.3 MINLP Formulation for a Fixed ... capacities The cost of the SSTC is the sum of the incremental costs of its movers, which depend on the streams and flow capacities 85    Chapter Work Exchange Networks Synthesis The costs of helper motor...

Ngày tải lên: 13/10/2015, 16:41

38 319 0
Tài liệu UNIT 7 : THE WORLD OF WORK –   Lesson 3 :  A.4

Tài liệu UNIT 7 : THE WORLD OF WORK – Lesson 3 : A.4

... week She works 20 hours a week She has about 12hours of homework every week She works about 13 hours a week before tests Tuesday, November 25th , 2010 THE WORLD OF WORK Lesson3: A student’s work( ... hours a week She has about hours of homework every week She works about hours a week before tests Tuesday, November 25th , 2010 THE WORLD OF WORK Lesson3: A student’s work( A4 ) I.Vocabulary: II Reading: ... than any worker But that is not all Hoa is a keen student and she studies hard She has about 12 hours of homework every week She also has to review her work before tests This makes her working...

Ngày tải lên: 03/12/2013, 16:11

20 1,3K 2
Gián án UNIT 7 : THE WORLD OF WORK –   Lesson 3 :  A.4

Gián án UNIT 7 : THE WORLD OF WORK – Lesson 3 : A.4

... week She works 20 hours a week She has about 12hours of homework every week She works about 13 hours a week before tests Tuesday, November 25th , 2010 THE WORLD OF WORK Lesson3: A student’s work( ... hours a week She has about hours of homework every week She works about hours a week before tests Tuesday, November 25th , 2010 THE WORLD OF WORK Lesson3: A student’s work( A4 ) I.Vocabulary: II Reading: ... than any worker But that is not all Hoa is a keen student and she studies hard She has about 12 hours of homework every week She also has to review her work before tests This makes her working...

Ngày tải lên: 03/12/2013, 16:11

20 840 0
Tài liệu The Go Big Now Guide - 5 Steps to Make the Law of Attraction Key Work for You docx

Tài liệu The Go Big Now Guide - 5 Steps to Make the Law of Attraction Key Work for You docx

... Steps to Make the Law of Attraction Key Work for YOU © Kristen Howe 2009 The Go Big Now Guide Steps to Make the Law of Attraction Key Work for YOU! Discover the Steps of the Law of Attraction that ... of Attraction work and YET, if you are like most people, it seems like the Law of Attraction STILL doesn’t work for you And now I’m here telling you that it IS working it just isn’t working for ... of a Master, Click here to read this classic for free The Center for Professional Well Being The Law of Attraction Key Blog, Law of Attraction Keys to make the Secret of Deliberate Creation work...

Ngày tải lên: 24/12/2013, 13:15

19 485 2
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt

Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt

... introduced on the end of the proposed synthetic trypsin inhibitor gene The sequences of the forward and reversed primers are shown on fig and of the synthetic gene is on fig Forward primer: GAATTCCATATGAGCGGCAGCGATGGCGGCGTGTGCCCGA ... MCo DNA as template The conditions for this experiment were established as: 150ng of each primer; 200àM of dNTPs ;400ng of the purified total MCo DNA Cloning of the synthetic MCoTI-II The PCR ... to N-terminus of a synthetic inhibitor As known, Mr of MCoTI-II is about 3.4kD, hence Mr of the obtained recombinant fusion protein should be about 58 kD ( the sum of 55 + 3.4kD of MCoTI-II) As...

Ngày tải lên: 12/02/2014, 10:20

9 499 0
Tài liệu Does Foreign Direct Investment Work For Sustainable Development? A case study of the Brazilian pulp and paper industry potx

Tài liệu Does Foreign Direct Investment Work For Sustainable Development? A case study of the Brazilian pulp and paper industry potx

... represented 98.4% of the foreign production of pulp in Brazil and 46.2% of paper production To elaborate the indicators of technological, environmental and social performance, the data were collected ... only 1.13% of their workforce in this kind of activity, foreign subsidiaries occupy 1.72% It is expressed as well in the number of graduates and posgraduates occupied by each group of firms: the ... expenditures in wages and benefits per worker Annual expenditure in human capital formation per worker Number of annual hours of training per worker* Participation of social expenditures in sales Brazilian...

Ngày tải lên: 22/02/2014, 09:20

23 896 0
21st Century Welfare: Presented to Parliament by the Secretary of State for Work and Pensions by Command of Her Majesty pptx

21st Century Welfare: Presented to Parliament by the Secretary of State for Work and Pensions by Command of Her Majesty pptx

... 28  Chapter Other areas of reform Chapter set out a number of options for structural reforms of the welfare system that could improve work incentives Many of the reforms suggested by external ... maintaining levels of support for those out of work; and •  rovide simpler support paid to those in or out of work, by simplifying the p complex array of overlapping in- and out -of- work means-tested ... and outline a set of principles to guide reform In addition, there are complex interactions with other forms of welfare support for basic needs (for example, the financing of affordable housing...

Ngày tải lên: 06/03/2014, 08:20

52 472 0
w