and implementation procedure of a pr program

báo cáo khoa học: "Improved delivery of cardiovascular care (IDOCC) through outreach facilitation: study protocol and implementation details of a cluster randomized controlled trial in primary care" doc

báo cáo khoa học: "Improved delivery of cardiovascular care (IDOCC) through outreach facilitation: study protocol and implementation details of a cluster randomized controlled trial in primary care" doc

... Ottawa, Ontario, Canada 2Department of Family Medicine, University of Ottawa, Ottawa, Ontario, Canada 3Institute of Population Health, University of Ottawa, Ottawa, Ontario, Canada 4School of Primary ... previous practice-based research studies [27-29] Data analysis A mixed-methods approach will be used, which will consist of analysis of both quantitative data and qualitative data Quantitative analysis ... completion of the program (15 Mainpro-C credits, Table Study design and progress of IDOCC program participation of practices and physicians as of April 2011 IDOCC program Study Design Intensive phase...

Ngày tải lên: 10/08/2014, 11:20

14 416 0
Marketing Strategy, Design and Implementation -Launching of a 3D Software Application

Marketing Strategy, Design and Implementation -Launching of a 3D Software Application

... data is analysed in chapter five The analysis consists of examination and categorisation of data to answer the research topics 2.2 Qualitative and Quantitative Approach Qualitative methods are ... that is offered by the marketer Tangible characteristics such as core product and packaging as well as intangible characteristics such as branding and warranties are included Many products are ... the goals and serves as a summary The basic components include a current and pro forma balance sheet, an income statement and a cash flow analysis A business plan helps the company to allocate...

Ngày tải lên: 19/12/2016, 12:18

58 340 0
Báo cáo y học: "Effects on management and outcome of severe sepsis and septic shock patients admitted to the intensive care unit after implementation of a sepsis program: a pilot study" docx

Báo cáo y học: "Effects on management and outcome of severe sepsis and septic shock patients admitted to the intensive care unit after implementation of a sepsis program: a pilot study" docx

... providing an early and appropriate sepsis management A large number of patients and a more detailed assessment of sepsis team activity before ICU admission appears mandatory for a better understanding ... test, and analysis of variance single-factor analysis were used when appropriate Univariate and multivariate logistic regression were performed, with hospital mortality as dependent variable and ... length of stay, and hospital mortality were also recorded for each patient Predicted hospital mortality was calculated by SAPS II score Hospital program The education phase of our hospital program...

Ngày tải lên: 13/08/2014, 19:20

8 283 0
NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx

NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx

... resources off the Straits of Malacca and the adjacent waters of the Andaman Sea and the Indian Ocean In the process, an attempt is made to identify, examine, and rank those threats that have transboundary ... meters and with a tidal stream of over knots The West Coast of Peninsular Malaysia has an equatorial climate, with an average annual rainfall of more than 2500mm and a daily temperature that ranges ... coast of Peninsular Malaysia such as Sg Muda, Sg Pinang, Sg Perak, and Sg Klang are short and steep Open water bodies, natural wetlands, and manmade lakes such as dams, and ex-mining pools are...

Ngày tải lên: 06/03/2014, 15:21

88 584 0
Research " CULTURE AND THE EFECTIVENESS OF SUPPLIER DIVERSITY PROGRAMS: A TEST OF PREDICTORS " doc

Research " CULTURE AND THE EFECTIVENESS OF SUPPLIER DIVERSITY PROGRAMS: A TEST OF PREDICTORS " doc

... improvement activities can have a positive impact on competitive advantage and firm performance (McGinnis and Vallopra 1999; Vonderembse and Tracey 1999) The term “supply chain management” is a new management ... only percent of business owners On the contrary, Asians and American Indians had business representation equal to or greater than their population numbers American Indians and Alaska Natives constitute ... a survey questionnaire First, the Internet dramatically improved the time and cost efficiency of the research The costs of postage and printing and was eliminated, and the time and cost of data...

Ngày tải lên: 16/03/2014, 03:20

84 345 0
Báo cáo y học: " Act In case of Depression: The evaluation of a care program to improve the detection and treatment of depression in nursing homes. Study Protocol" pptx

Báo cáo y học: " Act In case of Depression: The evaluation of a care program to improve the detection and treatment of depression in nursing homes. Study Protocol" pptx

... care program Act In case of Depression (AID), a multidisciplinary care program to identify and treat depression and monitor treatment effects The care program is based on and in accordance with ... is prearranged As the ability of nursing staff to detect depression can and should be enhanced [26], the multifaceted and multidisciplinary care program ‘AID’ starts with a training program for ... personal day structure program made by the nursing staff in collaboration with the recreational therapist Exercise and music therapy can be part of this day program Psycho-education is also offered...

Ngày tải lên: 11/08/2014, 15:22

7 485 0
Basic understanding about cancer and the importance of a national surveillance and research program in Vietnam

Basic understanding about cancer and the importance of a national surveillance and research program in Vietnam

... voluntary factors such as bad personal habits (cigarette smoking, and alcohol consumption), fatty diet, and sexual behavior and involuntary factors such as UV exposure, polluted air and contaminated ... gene leads to an activated BRAF protein that enhances melanoma growth and metastasis Targeting specifically the mutant BRAF protein and not the wild type BRAF protein in normal cells with small ... drastically reduced and overall health will improve The power of cancer surveillance and research in America Although the association of lung cancer with smoking is a perfect example for attacking...

Ngày tải lên: 20/06/2016, 23:20

7 464 0
Effect of unsaturated fatty acid esters of biodiesel fuels on combustion, performance and emission characteristics of a DI diesel engine

Effect of unsaturated fatty acid esters of biodiesel fuels on combustion, performance and emission characteristics of a DI diesel engine

... percentage of unsaturation, maximum heat release rate and peak pressure for karanjia biodiesel Biodiesel of karanjia has a lower percentage of unsaturation and has a higher value of maximum heat ... fuel Maximum gas pressure and exhaust gas temperature was observed in case of high unsaturated biodiesel Heat release rate and cumulative heat release rate is lower in case of high- unsaturated ... fuels are summarized in Table and Table A correlation analysis was made to find out the degree of linear association between different biodiesel properties and percentage of unsaturation The pearson...

Ngày tải lên: 05/09/2013, 15:28

20 483 0
An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends

An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends

... Since India has a large waste land area suitable for Jatropha cultivation, it can supply large volume of biodiesel, in fact, nearly half a dozen states of India have reserve a total of 1.72 million ... using heated distilled water was carried out to remove some unreacted remainder of methanol and catalyst which if not removed can react and damage storing and fuel carrying parts During washing ... Vitoloi S Brassica Carinata as an alternative oil crop for the production of biodiesel in Italy: engine performance and regulated and unregulated exhaust emissions Environmental Science and Technology...

Ngày tải lên: 05/09/2013, 16:11

12 571 0
Optimization of injection timing and injection pressure of a DI diesel engine fueled with preheated rice bran oil

Optimization of injection timing and injection pressure of a DI diesel engine fueled with preheated rice bran oil

... 349 Deepak Agarwal, Avinash Kumar Agarwal, Performance and emissions characteristics of Jatropha oil (preheated and blends) in a direct injection compression ignition engine, Applied Thermal Engineering ... performance and emission parameters were measured at different loads Finally, the rice bran vegetable oil was preheated using the exhaust gas temperature and used as fuel A heat exchanger was used ... subtropical southern Asia, and it is a staple food for a large part of the world’s human population especially in east, south and south-east Asia, making it the most consumed cereal grain Rice bran...

Ngày tải lên: 05/09/2013, 16:11

10 554 0
Tài liệu tiếng anh Điện tử công suất mạch MERS Loss and rating consideration of a wind energy conversion system with reactive compensation by magnetic energy recovery switch

Tài liệu tiếng anh Điện tử công suất mạch MERS Loss and rating consideration of a wind energy conversion system with reactive compensation by magnetic energy recovery switch

... higher than for the MERS case The influence of actual switch characteristics and thermal capability has been investigated An average peak junction temperature of 125°C and 80°C heat sink temperature ... Ryuichi Shimada, Jan A Wiik, Takanori Isobe, Taku Takaku, Noriyuki Iwamuro, Yoshiyuki Uchida, Marta Molinas, and Tore M Undeland A new ac current switch called mers with low on-state voltage igbts ... electrical conversion for permanent magnet wind generation References [1] T Takaku, G Homma, S Igarashi, Y Uchida, and R Shimada Power up and efficiency improvement of wind turbine generator by magnetic...

Ngày tải lên: 15/10/2013, 16:11

6 803 0
Tài liệu Elements of a PR Plan pptx

Tài liệu Elements of a PR Plan pptx

... relative cost of a good program is a lot less than for paid media or a direct mail campaign Best way to launch a brand Public relations is also considered by many as the best way to launch a brand ... Elements of a PR Program Table of Contents • Overview • Why Public Relations is Important • Elements of a PR Program Plan Media • Press Kits (Print and Electronic) • Develop Media Lists • Press Releases ... should be black -and- white glossy prints, color slides or transparencies Press packages may include black -and- white photos and state that color material also is available via your Web site’s press section...

Ngày tải lên: 23/12/2013, 00:15

15 441 1
A park like transformation for the study and the control of a nonsinusoidal brushless DC motor

A park like transformation for the study and the control of a nonsinusoidal brushless DC motor

... permanent magnets of the rotor : where L, and M, are the self-inductance and the mutualinductance of the stator coils Since we assume a constant airgap and no saturation, L, and M, are constant ara arb ... on a coordinate transformation and an input transformation as well But the main advantage of the Park transformation is to define an internal state variable which is physically meaningful : that ... The airgap length is constant and large since the magnets are surface mounted and have the same permeability as air As a result, the armature reaction is negligible The magnetic circuit has an...

Ngày tải lên: 03/01/2014, 19:44

8 518 1
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

... subunit molecular mass was also estimated by SDS–PAGE Characterization and comparative analyses of HYDJs and HYDBp The optimal temperature for activity of HYDJs with d-pHPH as substrate was determined ... Program of China (2007AA02Z205), the Knowledge Innovation Program of Shanghai Institute for Biological Sciences, Chinese Academy of Sciences (2007KIP102), and the National Basic Research Program of ... degradation pathway of uracil, thymine and several anti-cancer drugs [38] Interestingly, annotation of the DNA sequences flanking the Jannaschia sp CCS1 HYDJs revealed an ORF encoding a putative allantoate...

Ngày tải lên: 18/02/2014, 08:20

14 625 0
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al (1994) Omega-agatoxinTK containing D-serine at position 46, but not synthetic omega-[L-Ser46]agatoxin-TK, ... MOLMOL: a program for display and analysis of macromolecular structures J Mol Graph 14, 51–55, 29–32 Laskowski RA, Rullmannn JA, MacArthur MW, Kaptein R & Thornton JM (1996) AQUA and PROCHECK-NMR: programs ... assigned and integrated, with concomitant cycles of structure calculations for evaluation of distance and angle constraint violations as well as assignments of additional peaks based on the preliminary...

Ngày tải lên: 18/02/2014, 17:20

12 619 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢ For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the ... chain and hides a large amount of the hydrophobic surface area Surface area calculations for the pentamer give a total surface ˚ ˚ area of $ 81 000 A2 with 30% ($ 24 000 A2 ) as contact area Thus, ... 5¢-CTGCTGTCTACCTTTGGAGGTTGCTGATCCGAA TTCGAG-3¢ (forward) and 5¢-GCTCGAATTCGGATCAG CAACCTCCAAAGGTAGACAGCA-3¢ (reverse) BL21 cells were transformed with the pETM11 construct and grown until a D of 0.8...

Ngày tải lên: 19/02/2014, 06:20

10 648 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

... Luria–Bertani broth and isopropyl thio-b-d-galactoside were purchased from USB (Cleveland, OH) Salmon testes DNA and some analytical grade chemicals such as EDTA, Tris ⁄ HCl, CaCl2, NaCl and ... removal of a specific fragment can cause large changes in the native state of SNase Fig Steady-state fluorescent spectra of wild-type and mutant SNase Spectra of five proteins [wild-type (WT), W14 0A, ... (Mannheim, Germany) Ethanol (> 99%) was obtained from Panreac (Barcelona, Spain) Urea was a product of Acros (Pittsburgh, PA, USA) The QuickchangeTM kit containing Pfu DNA polymerase, 10 · reaction...

Ngày tải lên: 20/02/2014, 01:20

7 556 0
w