advances in technology and spinal fusion a clinician s perspective

... CHAPTER 3: ―DATA ANALYSIS AND FINDINGS‖ comprises data analysis, findings and discussion The CONCLUSION part demonstrates the conclusions of this piece of research, pedagogical implications, and ... events This is the mechanism which the semantic categories in, on and at activate to be used in abstract domains In the characterization of the abstract usage of prepositions, basic image schemas ... airport area Preposition on denotes physical contact between trajector and landmark, and necessitates viewing the landmark as one-dimensional space (a line) or two-dimensional space (a surface)

Ngày tải lên: 23/09/2020, 21:00

... sociolinguistics, pragmatics, and conversation analysis Conversation analysis of telephone conversations is a fairly well established area of investigation, beginning in the late 1960s with Schegloff ... research The first systematic investigation in this area dates back to Schegloff‟s (1968) analysis of telephone calls openings in the United States This and much of subsequent research was carried ... tradition in pragmatics, because its data remain open to any investigator inspection Any reader may test the claims by inspecting the transcriptions and recordings used as exemplars (Hopper,

Ngày tải lên: 30/09/2020, 13:04

... fields ofsociolinguistics, pragmatics, and conversation analysis Conversation analysis of telephoneconversations is a fairly well established area of investigation, beginning in the late 1960swith ... Ferdinand de Saussure, based on previous philologists andgrammarians‟ research on ancient written texts, found a new science describing facts ofspeech And today we reverse Saussure‟s lectures as ... is the outstanding empirical tradition in pragmatics, because its dataremain open to any investigator inspection Any reader may test the claims by inspectingthe transcriptions and recordings

Ngày tải lên: 08/11/2020, 14:41

... sociolinguistics, pragmatics, and conversation analysis Conversation analysis of telephone conversations is a fairly well established area of investigation, beginning in the late 1960s with Schegloff ... research The first systematic investigation in this area dates back to Schegloff‟s (1968) analysis of telephone calls openings in the United States This and much of subsequent research was carried ... tradition in pragmatics, because its data remain open to any investigator inspection Any reader may test the claims by inspecting the transcriptions and recordings used as exemplars (Hopper,

Ngày tải lên: 28/06/2022, 08:30

... Trang 1Valorization of mangosteen, ‘‘The Queen of Fruits,” and new advancesin postharvest and in food and engineering applications: A review Wan Mohd Aizata,⇑, Faridda Hannim Ahmad-Hashima, Sharifah ... [80] successfully fabricated a DSSC usinga-mangostin and anthocyanin extracted with different solvents, such as acidified acetone and ethanol Another study using a lithium bis(oxalato)borate-based ... materials (approximately less than 80 mesh) before drying at approximately 65°C AC is a good adsorbent, as it has a high sur-face area AC usage is perhaps among the easiest and cheapest water

Ngày tải lên: 14/01/2020, 00:08

... much a message of the analysis asspecialisation is The paradox vanishes when it is realised that specialisation isspecialisation in terms of the underlying resource-base (rather than products) and ... basicstory is that firms gradually accumulate excess resources as a (non-intended) consequence of their normal operations Tasks become routinised and this releases human resources,such as managerial ... corporate mission?’ or ‘What businesses are we in?’The content side of strategising is also increasingly cast in terms of resources Thus, ‘Ourstrategy is to get maximum market share in markets x,

Ngày tải lên: 30/01/2020, 08:19

... – Data Analysis, Findings and Discussion - presents the main findings of the research accompanied by the researcher‘s discussion The last chapter is Conclusion, grasping all the main points of ... trainees Trang 15Those findings and arguments are the main reasons triggering my research study 1.2 Educational context and participants 1.2.1 Setting of the chosen class The research was ... excessive stress and constraint students have to suffer during their interpretation training This piece of information was a valuable input to the researcher in planning for this particular research

Ngày tải lên: 26/08/2020, 23:06

... visit shops, offices, and places of scenic beauty; pay bills; read newspapers and magazines; receive letters from and send letters to almost every part of the world; learn foreign languages. Trang ... is a computer a miraculous device?• Computer is a miraculous device because it is capable of doing almost anything you ask it to do • -It is a calculating machine which speeds up calculations ... IN OUR LIFE. • (ONE ASKS, ONE ANSWERS, AND ONE REPORTS) Trang 17It is capable of doing anything you ask It can speed up calculations It can manage large / collection of data It can type and

Ngày tải lên: 13/04/2021, 05:15

... heterostructures such as GaInAs/AlInAs, GaAs/AlGaAs, and InAs/AlSb, 272 272 Advances in Lasers and Electro Optics Advances in Lasers and Electro Optics using electron subbands in ... accomplished by varying the structural parameters such as strain, alloy composition, and. .. conduction band QWs are shallow, and nearly all band offsets are in valence band Practically all ... and valence subband formations in a semiconductor... engineer the lifetimes of involved subbands Still, intersubband lasers offer advantages in areas where the conventional band-to-band

Ngày tải lên: 20/06/2014, 11:20

... optical sampler is the same as for commercial electrical sampling oscilloscopes A schematic about the sampling principle is displayed in Fig 3 In an ideal sampling, the signal to be measured S(t), ... complex all optical techniques and fast electronics For this reason, it is useful an asynchronous sampling operation An Asynchronous all optical Sampling Oscilloscope based on FWM in HNLF (ASOF) has ... digital sampling oscilloscopes use analod to digital convertersi (ADC) to sample the signal at discrete points in time and convert the signal’s voltage at these points into digital values called sample

Ngày tải lên: 20/06/2014, 11:20

... functions. In past two decades, many schemes have been proposed to demonstrate all-optical signal processing functions, and nonlinearities in passive and active waveguides, such as high nonlinear ... nearly all functions for all-optical signal processing. In SOAs, nonlinear effects such as cross-gain modulation (XGM), cross-phase modulation (XPM), four-wave mixing and transient cross-phase ... shown in Fig.1, a SOA is cascaded with two basic filters: an optical bandpass filter (OBF) and a delay Fig. 1. Schematic diagram for signal processing with SOA and filters SO A pump probe

Ngày tải lên: 20/06/2014, 11:20

... respectively 2.1 Case “SOA“ In this first deterioration case, another SOA was used to deteriorate the modulated input signal at λ1 This SOA acted as a booster, amplifying and adding ASE noise ... 2009a) A study of the case “LINK+SOA” was done in a similar manner, obtaining the results presented in Figure 11(b) In this case, a gain variation of 0.9 dB and a Q-factor improvement variation ... varying the laser 1 power level and/or the bias current of the SOA used as a booster Trang 142.2 Case “LINK+SOA“ In this deterioration case the modulated signal is degenerated by dispersion and

Ngày tải lên: 20/06/2014, 11:20

... 42 21 )sin( ;)sin( )cos( ;/ ;4 4 )sin( )cos( 2)sin( )cos( 2 ;)sin( )cos( 2)sin( )cos( 2 2 1 , , 2 2 2 1 , , 2 1 , , 2 1 B A c B A c B A k ss ss R ss ss R ss ss R ss ss R B ss ss R ss ss R A t d ... EDFAs’ stages compensates for the power loss in each span, except in the last span In this case, the second stage EDFA is used to impose a power level of 0 dBm at the RX input The SSMF has an attenuation ... performance evaluation of simulated optical DQPSK modulation has been analysed The EDP of DQPSK signals is approximately Gaussian-distributed Thus, a SASM for DQPSK systems performance evaluation based

Ngày tải lên: 20/06/2014, 11:20

... telephone call openings appear at first sight to be a relatively simple and invariable routine, there is actually great variation in the way they are realized across languages, institutions and individuals ... tradition in pragmatics, because its data remain open to any investigator inspection Any reader may test the claims by inspecting the transcriptions and recordings used as exemplars (Hopper, ... systematic investigation in this area dates back to Schegloff s (1968) analysis of telephone calls openings in the United States This and much of subsequent research was carried out within the Conversation...

Ngày tải lên: 02/03/2015, 14:37

... heterogeneous range of business establishments in the following categories: hotels, guesthouses, self-catering accommodation, bed and breakfasts, hostels, caravan and camp-sites, restaurants, activities ... population of Hispanics has already surpassed that of African Americans The structure of race in the US is changing dramatically and diversity issues are one of the major issues in understanding ... was considered to fulfil these criteria, insofar as it was Ireland s first local destination quality brand, and since its inception has gained widespread recognition as a successful tourism marketing,...

Ngày tải lên: 04/04/2013, 11:21

... antagonist (antivitamin) of folic acid aminosalicylates 5-Aminosalicylate and its derivatives (balsalazide, mesalazine, olsalazine, sulphasalazine) used in treatment of ulcerative colitis aminotransferase ... name of ptyalin) and pancreatic amylase are both α-amylases Major sources of α-amylase in the baking and brewing industries are Aspergillus oryzae (fungal amylase) and Bacillus subtilis, in addition ... gradually breaks down Used in soft drinks, dessert mixes and as a ‘table top sweetener’ Trade names Canderel, Equal, Nutrasweet, Sanecta Because aspartame contains phenylalanine, it is specifically...

Ngày tải lên: 21/08/2013, 13:55

... Loss Processing • UDT loss processing – Most loss are continuous – Record loss event other than lost packets – Access time is almost constant Access Time (us) 0 10 20 30 40 50 60 Loss Events ... Efficiency and Fairness Characteristics • Takes 7.5 seconds to reach 90% of the link capacity, independent of BDP • Satisfies max-min fairness if all the flows have the same end-to-end link capacity ... Outline • • • • • TCP s inefficiency in grid applications UDT Design issues Implementations issues Conclusion and future work TCP and AIMD • TCP has been very successful in the Internet – AIMD (Additive...

Ngày tải lên: 15/01/2014, 15:59

... Technical Assessment Systems (TAS) (1989) Exposure Software Package Technical Assessment Systems, Washington, DC Theranaturals (2000) Theranaturals I3C Caps Available at http://www theranaturals.com ... (includes tissues of the nose, nasal turbinates, paranasal sinuses, and trachea); nrv, nervous system; orc, oral cavity (includes tissues of the mouth, oropharynx, pharynx, and larynx); ova, ovary; ... Press, Washington, DC National Research Council (1996) Carcinogens and Anticarcinogens in the Human Diet: A Comparison of Naturally Occurring and Synthetic Substances. Natl Acad Press, Washington,...

Ngày tải lên: 14/02/2014, 22:20

... book is also about maintaining and increasing the passion one originally had for being a professional in the healing arts Everything that initially attracted people to this fascinating, meaningful, ... workload, within shrinking financial and material resources Increasing consumerism has resulted in both increasing demands and expectations from patients In addition, doctors find themselves also accountable ... colleagues in a way that unnecessarily increases stress After Tacking on Dangerous Psychological Waters 23 Table 1-2 Conflicts with Peers, Staff, and Administrators Peer Conflict Schedules and calendars...

Ngày tải lên: 06/03/2014, 13:20

... AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT ... yeast strain induced at 15 °C, and from yeast expressing SSTR2 as a control activity By taking advantage of structural and functional similarities between yeast and mammalian GPCR signaling pathways, ... expression vector was obtained from pJH2-SSTR2 by homologous recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢)...

Ngày tải lên: 07/03/2014, 16:20