Ngày tải lên: 17/03/2014, 19:20
... was a pragmatic (i.e. UK) version of audio-lingualism; the key difference from the audio- lingual approach was that the language presentation and practice was situationalised and so was always ... account of so-called ‘affective’ factors in language teaching, and UK language teaching was famous for its engaging and ‘fun’ qualities; however, the philosophy of the humanistic approaches was valuable, ... the USA, and particularly championed by Earl Stevick, this movement was based on the assumption that language classes were places of fear for language learners; specifically associated with:...
Ngày tải lên: 16/01/2014, 23:20
Tài liệu Báo cáo khoa học: "A Selectionist Theory of Language Acquisition" docx
... that the learner be modeled as a pop- ulation of "grammars", the set of all principled lan- guage variations made available by the biological en- dowment of the human language faculty. ... grammars Learning, including language acquisition, can be characterized as a sequence of states in which the learner moves from one state to another. Transfor- mational models of language acquisition ... grammars. 2.6 Learning in a Parametric Space Suppose that natural language grammars vary in a parametric space, as cross-linguistic studies sug- gest. 3 We can then study the dynamical behaviors...
Ngày tải lên: 20/02/2014, 19:20
Báo cáo khoa học: The twin-arginine translocation (Tat) systems from Bacillus subtilis display a conserved mode of complex organization and similar substrate recognition requirements doc
... RTEAyF (5¢-CGCGTCTCGCATGCCGATCGGTCCTGGAAGCCT TGCTG-3¢) and JJystrep02 (5¢-ATATTCTAGATTA TTT TTCAAACTGTGGGTGCGACCAATTCGATTGCCCAG AAGACACGTCCCG-3¢). RTEAyF was designed as such that restriction of the generated tatAyCy–strep ... a common feature of all Tat systems analysed in this way to date [12,21]. Gel-filtration chromatography reveals a TatAyCy complex of 200 kDa Apart from the absence of a TatB component, the ear- lier ... membrane-association of precur- sor proteins in other studies and we favour the expla- nation that the membrane-assocation is nonspecific [26]. Characterization of separate TatAyCy and TatAy complexes...
Ngày tải lên: 16/03/2014, 04:20
Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc
... lacks the 3¢-phospho-ADP moiety of CoA, having a pivalate group at the 11-hydroxyl moiety of pantetheine instead (Fig. 1). The acetyl and acetoacetyl thioesters of PP (Ac-SPP and AcAc-SPP) have ... positioning of substrate in the thiolase catalytic pocket. Furthermore, calorimetric assays indicate that the mutation of Cys89 into an alanine significantly decreases the affinity of thiolase towards CoA. ... purification and crystallization Z. ramigera thiolase and its C8 9A mutant were expressed and purified as previously described [2,9]. Crystallization of wild-type thiolase and its C8 9A variant were carried...
Ngày tải lên: 16/03/2014, 04:20
A Quick Tour of the C++CLI Language Features
... such a class is not quite the same as an interface. An interface class has no fields and no method implemen- tations; an abstract base class may have these. Also, multiple interface classes may ... by a class, whereas only one noninterface class may be inherited by a managed type. We want to model radioactive decay. Since most atoms are not radioactive, we don’t want to add radioactivity ... this example. The previous sections demonstrated the declaration and use of managed aggregate types, including ref classes, value classes, managed arrays, enum classes, and interface classes....
Ngày tải lên: 05/10/2013, 08:20
Tài liệu A Brief History Of The English Language Eckersley 1960 ppt
Ngày tải lên: 25/12/2013, 13:15
Tài liệu Báo cáo khoa học: Crystal structures of a bacterial 6-phosphogluconate dehydrogenase reveal aspects of specificity, mechanism and mode of inhibition by analogues of high-energy reaction intermediates pdf
... structures of a bacterial 6-phosphogluconate dehydrogenase reveal aspects of specificity, mechanism and mode of inhibition by analogues of high-energy reaction intermediates Ramasubramanian Sundaramoorthy 1 , ... suite: programs for protein crystallo- graphy. Acta Crystallogr D Biol Crystallogr 50, 760–763. 28 Navaza J (1994) Amore – an automated package for molecular replacement. Acta Crystallogr A 50, 157–163. 29 ... be an associated water molecule. Our interpretation was that the smaller compound PEA (Fig. 1B) and a water molecule are present and PEX and PEA refined satisfactorily with occupancies of 0.7 Table...
Ngày tải lên: 19/02/2014, 05:20
Báo cáo khoa học: "Creative Language Retrieval: A Robust Hybrid of Information Retrieval and Linguistic Creativity" pot
... explore how an IR system can itself provide a degree of creative anticipation, acting as a mediator between the lit- eral specification of a meaning and the retrieval of creative articulations of this ... expansion. Fortunately, statistical corpus analysis is an ob- vious area of overlap for IR and FLP. Distribu- tional analyses of large corpora have been shown to produce nuanced models of lexical ... Google ngrams include coffee, raisin, almond, carob and soybean. Ad-hoc categories allow users of IR to remake a category system in their own image, and create a new vocabulary of categories...
Ngày tải lên: 07/03/2014, 22:20
Báo cáo khoa học: Exo-mode of action of cellobiohydrolase Cel48C from Paenibacillus sp. BP-23 A unique type of cellulase among Bacillales ppt
... cellulase of 1091 amino acids with a deduced molecular mass of 118 kDa and a pI of 4.85, displayed a multidomain organ- ization bearing a canonical family 48 catalytic domain, a bacterial type 3a cellulose-binding ... Cel48C from Paenibacillus sp. BP-23 A unique type of cellulase among Bacillales Marta M. Sa ´ nchez, F. I. Javier Pastor and Pilar Diaz Department of Microbiology, Faculty of Biology, University of Barcelona, ... Pla de Recerca de Catalunya (Generalitat de Catalunya), grant 2001SGR- 00143, and by the Generalitat de Catalunya to the ÔCentre de Refere ` ncia en BiotecnologiaÕ (CeRBa). M. Sa ´ nchez is a...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx
... Introduction Parameter estimation is fundamental to many sta- tistical approaches to NLP. Because of the high-dimensional nature of natural language, it is often easy to generate an extremely large ... is a version of Boosting with Lasso (L 1 ) regularization. We first investigate all of our estimators on two re-ranking tasks: a parse selection task and a language model (LM) adaptation task. ... 2007. c 2007 Association for Computational Linguistics A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing Jianfeng Gao * , Galen Andrew * , Mark Johnson *& ,...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo khoa học: "A Word-Order Database for Testing Computational Models of Language Acquisition" docx
... acquisition. 2 The Language Domain Database The focus of the language domain database, (hereafter LDD), is to make readily available the different word order patterns that children are typically exposed ... All grammar settings and annotations are saved and available the next time the user logs on. Finally on the Data Download page, users may download data so that they can use the patterns and ... Selection and Data Download. First a user has to specify, on the Grammar Selection page, which settings of the 13 parameters are of interest and save those settings as an available grammar. A user...
Ngày tải lên: 08/03/2014, 04:22
Báo cáo khoa học: "A Computational Theory of ProseStyle for Natural Language Generation" ppt
... The Ashanti are an AKAN-speaking people of central Ghana and neighboring regions of Togo and Ivory Coast, numbering more than 900,000. They subsist primarily by farming cacao, a major cash ... structure at the point of attachment. /s NP ¢ V P 1lie Ashanti V- ~NP N /• ~N Akan-speaking Figure 8 Attachment of 0ar~uage #>Akan) 5, Comparisons with other Research in Language Generation ... relative clauses, not all full clauses can be reduced to participial adjectives. 2. The characteristics of the available attachment points, especiafly the grammatical constraints that they...
Ngày tải lên: 09/03/2014, 01:20
Báo cáo " Influence of laser parameters on the stationary operation of a two-mode random micro laser " pdf
... influence of laser parameters on saturated values of mode photon densities, we vary one of parameters in table 1 and remain invariable all the rest of parameters. The obtained results are shown ... Abstract. Solving the system of equations describing the stationary operation of a two -mode random microlaser we have found the transformation of saturated values of mode intensity when laser ... photon densities of mode 1 and 2. These equations (1), (2) have been solved numerically by the Matlab language with chosen values of parameters shown in Table 1 (as seen in [12]). Table 1. 1 1...
Ngày tải lên: 14/03/2014, 13:20
HYGIENIC PHYSIOLOGY WITH SPECIAL REFERENCE TO THE USE OF ALCOHOLIC DRINKS AND NARCOTICS BEING A REVISED EDITION OF THE FOURTEEN WEEKS IN HUMAN PHYSIOLOGY ppt
... Leidy's "Human Anatomy," and Sappey's "Traité d'Anatomie" have been followed on all anatomical questions, and have furnished many beautiful drawings. Huxley's ... of solid oak.] and also a larger surface for the attachment of the muscles. The Composition of the Bones at maturity is about one part animal to two parts mineral matter. The proportion varies ... manhood, and are a cause of lifelong regret. The use of a strained limb may permanently damage it. Some silly feat of strength may produce an irreparable injury. A thoughtless hour of reading...
Ngày tải lên: 15/03/2014, 13:20
Báo cáo khoa học: "The Human Language Project: Building a Universal Corpus of the World’s Languages" pptx
Ngày tải lên: 16/03/2014, 23:20
A Brief History of the English Language and Literature, Vol. 2 doc
Ngày tải lên: 17/03/2014, 02:20
Bạn có muốn tìm thêm với từ khóa: