a si h thin film solar cells

Design, construction and testing of an i v tester for thin film solar cells and mini modules

Design, construction and testing of an i v tester for thin film solar cells and mini modules

... thesis The thesis is arranged as follows Chapter 2 primarily gives a review of the basic principles and characterization aspects of solar cells and I-V measurement techniques The various light ... the solar array Thus, the load of the solar device changes from zero to a very large value during the capacitor charging period and I-V characteristics of the solar device is acquired by sampling ... would also like to thank Dr Per Ingemar WIDENBORG, Dr Jidong LONG, Dr Premachandran VAYALAKKARA, Ms Juan WANG and Mr Jonathan ZHANG from the Solar Energy Research Institute of Singapore (SERIS) and...

Ngày tải lên: 04/10/2015, 15:45

77 527 0
fabrication and characterization of al2o3 si composite nanodome structures for high efficiency crystalline si thin film solar cells

fabrication and characterization of al2o3 si composite nanodome structures for high efficiency crystalline si thin film solar cells

... Trang 1high efficiency crystalline Si thin film solar cellsRuiying Zhang, Jian Zhu, Zhen Zhang, Yanyan Wang, Bocang Qiu, Xuehua Liu, Jinping Zhang, Yi Zhang, Qi Fang, Zhong Ren, and Yu Bai ... Al2O3layer with the identical thickness was also deposited on a separate planar Si surface The planar Si sample was used to measure the optical parameters of Al2O3for simulations and to compare ... Compared with the planar Si solar cells, the absorption is clearly enhanced in nanodome decorated Si solar cells The absorption is further enhanced when the nanodomes were cladded with Al2O3film...

Ngày tải lên: 04/12/2022, 10:34

11 4 0
Interface studies for microcrystalline silicon thin film solar cells deposited on TCO coated planar and textured glass superstrates

Interface studies for microcrystalline silicon thin film solar cells deposited on TCO coated planar and textured glass superstrates

... Kirchartz, B.E. Pieters, C. Ulbrich, A.M. Ermes, S. Schicho, A. Lambertz, R. Carius, U. Rau, Characterization and simulation of a-Si:H/μc-Si:H tandem solar cells, Solar Energy Materials and Solar ... Yonekura, H. Takatsuka, Development of large-area a-Si:H films deposition using controlled VHF plasma, Thin Solid Films, 506–507 (2006) 22-26. [177] H. Mashima, H. Yamakoshi, K. Kawamura, Y. Takeuchi, ... they are my best cleanroom buddies and made the time staying in the lab full of laughs. Thanks to Dr. Bram Hoex, Dr. Per Ingemar Widenborg, Nasim Sahraei Khanghah, Dr. Selvaraj Venkataraj, Dr. Vayalakkara...

Ngày tải lên: 09/09/2015, 11:16

232 532 0
Investigation of advanced light trapping concepts for plasma deposited solid phase crystallised polycrystalline silicon thin film solar cells on glass

Investigation of advanced light trapping concepts for plasma deposited solid phase crystallised polycrystalline silicon thin film solar cells on glass

... scattering theory with the ASA thin-film solar cell simulator, the parasitic glass absorption and the c-Si absorption for poly-Si thin-film solar cells on textured glass can be separately estimated The ... polycrystalline silicon thin-film solar cells on glass 1.3 Polycrystalline Si thin-film solar cells The polycrystalline Si (poly-Si) thin-film solar cell technology is another important thin-film ... poly-Si thin-film solar cells on glass at SERIS 2.2.1 Poly-Si fabrication and treatment In our research group at SERIS, we use a similar approach as that of CSG Solar [1] to fabricate poly-Si thin-film...

Ngày tải lên: 09/09/2015, 11:16

146 534 0
Immobilized cell hollow fiber membrane bioreactor for lignocellulosic bioethanol production

Immobilized cell hollow fiber membrane bioreactor for lignocellulosic bioethanol production

... them Zymomonas mobilis (Mazaheri, Shojaosadati et al 2012; Wirawan, Cheng et al 2012; Chandra, Abha et al 2013), Saccharomyces cerevisae (Zaldivar, Roca et al 2005; Sindhu, Kuttiraja et al 2011; ... Dr Satyen Gautam, Dr Karthiga Nagarajan, Dr Vivek Vasudevan, Dr Cheng Xiyu, Ms Phay Jia Jia Two other labmates I would like to mention specially ii are Dr Prashant Praveen and Ms Vu Tran Khanh ... research, the SHFMB was used to simultaneous saccharification and co-fermentation of Jatropha curcas fruit hull at high solid loadings for high ethanol titer Jatropha curcas fruit hull slurry obtained...

Ngày tải lên: 09/09/2015, 11:09

176 697 0
Development of hollow fiber membrane bioreactors for two phase biodegradation of phenol

Development of hollow fiber membrane bioreactors for two phase biodegradation of phenol

... aqueous and an organic phase for non-dispersive solvent extraction has been a widely investigated research area (Ana Maria and Anil Kumar 2008; Asimakopoulou and Karabelas 2006; Cichy and Szymanowski ... combines the advantages of both extraction and adsorption resulting in high cell growth and biodegradation rates On the other hand, liquid NAPs have the advantages of easy handling, high partition ... the solvent has a high viscosity Agitation rates as high as 600 RPM have been reported during pyrene biodegradation using silicone oil as the organic phase (Mahanty et al 2008), which may be difficult...

Ngày tải lên: 30/09/2015, 06:22

231 490 0
Symbiotic hollow fiber membrane photobioreactor for microalgal growth and activated sludge waste water treatment

Symbiotic hollow fiber membrane photobioreactor for microalgal growth and activated sludge waste water treatment

... concentration in the AS-SHFMP can be as high as 2.5 g/L, ix significantly higher than the microalgae concentration in the high rate algal pond (HRAP) systems In conclusion, this study has facilitated ... crustaceans and fish The most frequently used species in aquaculture are Chlorella, Tetraselmis, Isochrysis, Pavlova, Phaeodactylum, Chaetoceros, Nannochloropsis, Skeletonema and Thalassiosira (Apt ... biomass for the production of human and animal nutrition, and other high-value added chemicals This is because microalgae can accumulate lipid, protein, and carbohydrate with percentages are similar...

Ngày tải lên: 09/09/2015, 11:31

221 1,3K 0
Hollow fiber membrane design for membrane distillation (MD) and MD based hybrid processes

Hollow fiber membrane design for membrane distillation (MD) and MD based hybrid processes

... distillation systems, Desalination, 299 (2012) 5562 [50] J .A Prince, G Singh, D Rana, T Matsuura, V Anbharasi, T.S Shanmugasundaram, Preparation and characterization of highly hydrophobic poly(vinylidene ... porosity as high as 80% and thickness smaller than 50 µm were fabricated, which enhanced the MD performance dramatically Companies and orgaizations like Gore and Associates (USA), Swedish Development ... [3] The plasma modification increased the contact angle of the membranes to around 120º The authors also reported the stable membrane performance with no leakage and high salt rejection Cheng and...

Ngày tải lên: 10/09/2015, 09:08

254 452 0
Fabrication of nanofiltration hollow fiber membranes for sustainable pharmaceutical manufacture

Fabrication of nanofiltration hollow fiber membranes for sustainable pharmaceutical manufacture

...  and  are 12 available At a higher NaCl concentration, the membrane seems to have a larger calculated charge density The effective charge density, X, can be related to the NaCl concentration ... sustainable pharmaceutical manufacture Pharmaceuticals have been making significant contributions to the healthcare of human beings over the past number of decades However, recently there is a ... nanofiltration performance AFM images demonstrate that a high take-up speed favors the “spinodal decomposition” rather than “nucleation and growth”, which increases surface porosity and thus increases...

Ngày tải lên: 12/09/2015, 11:29

158 512 0
Fundamentals of hollow fiber formation for gas separation

Fundamentals of hollow fiber formation for gas separation

... while these macro-voids are apparently eliminated or suppressed when the shear rate increases to 2436 s-1[29] It is clear that high shear rates change the precipitation path and retard the macrovoid ... the inherent chemical and physical properties of the membrane material are very important for membrane formation A good membrane material should possess a reasonably large molecular weight and ... extrusion as the shear rate increases [30] Both the sizes of the nodules in the fiber spinning and transversal directions decrease with increasing shear rate possibly because of the chain disentanglement...

Ngày tải lên: 14/09/2015, 08:46

218 387 0
Development of novel chitosan based hollow fiber membranes for applications in water treatment and bioengineering

Development of novel chitosan based hollow fiber membranes for applications in water treatment and bioengineering

... with reasonably good mechanical strength and high adsorption capacity for heavy metal ions However, a practical problem arising from this method was the high viscosity of the dope solutions that ... opposite charge with that on the membranes can pass through the membranes while those with the same charge are rejected A typical example of such process is electrodialysis In fact, some membrane ... ultrafiltration and nanofiltration are the typical membrane processes utilizing the size exclusion mechanism Another mechanism is the sorption-diffusion mechanism, where components that have higher affinity...

Ngày tải lên: 14/09/2015, 08:49

230 406 0
Development of chitosan based blend hollow fiber membranes for adsorptive separation in environmental engineering and bioengineering applications

Development of chitosan based blend hollow fiber membranes for adsorptive separation in environmental engineering and bioengineering applications

... inorganic film is subjected to high-energy particle radiation applied perpendicular to the film The film is then immersed in an acid or alkali bath to etch away the materials along the tracks The ... is based on the charge characteristics of the components to be separated In such process, the membranes are electrically charged and only species that have the opposite charge with that on the ... because of the fast phase separation rate on the membrane surface since a high amount of nonsolvent is immediately available near the surface In the sublayers of the membranes, large voids are...

Ngày tải lên: 14/09/2015, 11:42

227 962 0
Dual layer hollow fiber membrane development for forward osmosis and osmosis power generation

Dual layer hollow fiber membrane development for forward osmosis and osmosis power generation

... polymer chains after thermal annealing Clearly, the annealed PBI/POSS-PAN/PVP dual layer membrane is significantly stronger than the PBI-PBI fiber and can greatly expand the practical applications ... Cost-effective and mechanically strong dual-layer hollow fibers Comparing to single-layer membranes, dual-layer membranes have two major advantages Since most functional materials for separation are much ... Using this method, we can choose a material with good chlorine resistance and salt rejection properties as the selective layer and a cheap but mechanically strong polymer as the substrate layer...

Ngày tải lên: 04/10/2015, 17:06

83 386 0
The development of pervaporation hollow fiber membranes for isopropanol dehydration

The development of pervaporation hollow fiber membranes for isopropanol dehydration

... facilitated the crosslinking reaction, while a high-temperature heat treatment caused the reaction reversed The separation factor was further enhanced after heat treatment with a loss in flux Jiang ... autoclave Ceramic membranes show high water permeation flux and relatively high separation factor for alcohol dehydration [65] The major drawbacks of inorganic membranes are (1) the higher cost ... vapor permeate at each side of the membrane Different from other membrane processes, pervaporation has the phase change across the membrane [10-12] Figure 1.1 illustrates the schematic diagram...

Ngày tải lên: 16/10/2015, 15:38

164 699 0
Báo cáo khoa học: Critical role of the plasma membrane for expression of mammalian mitochondrial side chain cleavage activity in yeast pptx

Báo cáo khoa học: Critical role of the plasma membrane for expression of mammalian mitochondrial side chain cleavage activity in yeast pptx

... 5¢-AGACTTTCAAACGAATAATAACTT CAGCAATAAAAATTGTCCAGGTTAATtccagcgacatg gaggccc-3¢ and 3¢ATF2-Kan: 5¢-TTGTACGAGCTCGG CCGAGCTATACGAAGGCCCGCTACGGCAGTATC GCAcattcacatacgattgacgc-3¢ (nucleotides in lower case are specific to the ... cactaaattaataatgaccggatcATGTACTTCCCCTTTTTAGG CAGAT-3¢) and lip2 (5¢-cagtagagacatgggagatcccccgcgg aattcgagctcggtacccgggTCATTCTTTATTTAGAGCATC CAGC-3¢) The sequences in lower-case are complementary ... (Table 1) The APAT-deficient strain, CA14, was generated by disrupting the ATF2 gene of CA10 with the KanMX4 cassette, which confers G418 resistance Primers 5¢ATF2-Kan 5¢-AGACTTTCAAACGAATAATAACTT...

Ngày tải lên: 08/03/2014, 08:20

13 443 0
Dual layer asymmetric hollow fiber membranes for gas separation

Dual layer asymmetric hollow fiber membranes for gas separation

... The thoughts he has offered have enriched my thesis a lot The things I have learned from him are never just only the sense of research but the mission for ‘never give-up’ and many others Apart ... Purge gas Syngas ratio adjustment CO2/ Hydrocarbons Acid gas treatment, landfill gas upgrading H2 O/ Hydrocarbons Natural gas dehydration H2 S/ Hydrocarbons Sour gas treating He/ Hydrocarbons Helium ... et al., 1964) They can therefore achieve both high flux and sufficient mechanical strength The flux of the asymmetric membranes invented by Loeb and Sourirajan was at least tenfold higher than...

Ngày tải lên: 16/09/2015, 17:11

267 530 0
Extractant impregnated hollow fiber membranes for phenol recovery from wastewater

Extractant impregnated hollow fiber membranes for phenol recovery from wastewater

... the reactor High agitation rates have to be maintained to keep the particles afloat and their surface area exposed for adsorption Maintaining high agitation in large scale industrial applications ... formation, density difference between the aqueous phase and NAP should be high; this constraint narrows down the choices of available NAPs This is especially the case when polar pollutants are ... they are washed thoroughly and dried using blotting paper or tissue paper (Burghoff et al., 2010) Figure 2.3 shows a schematic diagram of a SIR particle and the extraction mechanism where S and...

Ngày tải lên: 30/09/2015, 10:12

101 477 0
Cell based screening assay for inhibitors of porcine circovirus type2 (PCV2) replication

Cell based screening assay for inhibitors of porcine circovirus type2 (PCV2) replication

... To the  JIBES, thank you for making life outside the lab and lecture memorable. To Patricia, who has been my life  raft these past 2 years; to Casey, Mad, Ed, Sukriti, Hanwern, Neisha, and Ashley, thank you for all the fond  ... PDNS is a fatal but sporadic disease first recognized in 1993 and affects pigs 12‐14 weeks  of age (Chae, 2005). It has been reported in Asia and North America and is characterized by the  appearance  ... treated with the drugs for 6 hours after overnight infection with PCV2    2. 5 Generation of Graphs and Statistical Analyses  Graphs  and  statistical  analyses  were  generated  using  GraphPad  Prism  ver.  5.04  (GraphPad  Software,  San ...

Ngày tải lên: 03/10/2015, 11:36

59 352 0
Cell based screening assay for inhibitors of porcine circovirus type2 (PCV2) replication 2

Cell based screening assay for inhibitors of porcine circovirus type2 (PCV2) replication 2

... would be amenable to HTS. A Z’ factor of > 0.5 indicates amenability for HTS, while a value between 0  and  0.5  indicates  faulty  reagents  or  suboptimal  assay,  and  a negative  value  indicates  that  the  assay  results to variable data and not amenable for HTS (Inglese et al., 2007; Sui and Wu, 2007).  Z values for  ... Another parameter for assessing assay robustness and repeatability is the Z’ factor (Zhang et al.,  1999; Sui and Wu, 2007). Since it takes into consideration the variability of values both from the control  ... that could effectively inhibit PCV2 replication and this study was aimed at addressing this issue through  the  establishment  of  a primary  screening  assay  in  an  effort  to  facilitate  drug  discovery  against  PCV2  replication. The assay was developed by monitoring the expression of Rep protein through IFA to assess ...

Ngày tải lên: 13/10/2015, 16:41

29 317 0
Tài liệu Báo cáo khoa học: Simplified yet highly accurate enzyme kinetics for cases of low substrate concentrations ppt

Tài liệu Báo cáo khoa học: Simplified yet highly accurate enzyme kinetics for cases of low substrate concentrations ppt

... dimensions and embedded in one another In this setting, there are no unique transient and partially relaxed phases, but rather a cascade of as many phases as timescales, with each consecutive phase ... QSSA manifold on their way to the steady state, which is an indication that the former is closer to a SIM than the latter Using these plots and having measured the concentration of EIIAặP, the ... molecules, as is the case, for example, in metabolic pathways However, as cell biology has developed, attention has shifted away from major metabolic pathways to pathways of gene expression and signal...

Ngày tải lên: 18/02/2014, 06:20

16 568 0
w