a self tunable index for moving objects

... characteristics of moving objects, spatial databases were used for managing location data in moving- object applications in the early 1990s However, since spatial databases are designed for managing ... Btree—an index for moving objects that can automatically adjust itself to adapt to workload changes in moving- object databases We also present an adaptive updating mechanism to minimize the updating ... remarkable improvement in the speed of data retrieval, indexes also require additional storage space and introduce additional overhead on database updates Traditional databases are optimized for...

Ngày tải lên: 09/09/2015, 18:53

... investigator from CONICET We acknowledge Diana Wetzler for assistance with CD data analysis and Guillermo Solovey for assistance with ProFit programming We thank Liliana Alonso for careful corrections ... dissociation constant and Po is the total peptide concentration The last term in the equation takes into account slight aggregation that may take place at higher 984 Data analysis We used TFE and ... saturation was achieved The stoichiometry was determined by extrapolation of two linear fits of the initial and final anisotropy signals For all reactions tested, full saturation was achieved at a...

Ngày tải lên: 22/03/2014, 21:20

... Council of Canada, Ottawa, Ontario, Canada, 2002 14 [29] D N Zotkin and R Duraiswami, “Accelerated speech source localization via a hierarchical search of steered response power,” IEEE Transactions ... correlation (clean signal) Figure 11: Evaluation of location estimates by aggregating the results of several measurements The evaluation of location estimates was performed for both clean and noisy ... localization, including this paper, assume that noise is uncorrelated across the array although this as- Performance in different acoustic environment The performance evaluation of localization...

Ngày tải lên: 22/06/2014, 19:20

... walk a mile than it would to walk a block If such a state of a airs had always existed then primitive man never would have needed to judge that a day’s walk was once again as far as half a day’s ... his change the clerk hands him pennies and says “25”; then he hands him a quarter and says “50,” and finally he hands him a half-dollar and says “and 50 makes $1.00.” He has performed the operation ... you have a certain balance in the bank to your credit and you have made, let us say, four checks against it, and that you want to know what the balance is after the amounts of the checks have...

Ngày tải lên: 28/06/2014, 19:20

... GGTCGACTTATATATTTATGAACACATTTA and CCCGGGATAACTTCGTATAATGTATGCTATACGAACGGTATCCTGAAATGGGGTCACCACACT The second primer contains at its end a LoxP sequence This site was inserted to potentially allow ... Mammalian cDNA and prokaryotic reporter sequences silence adjacent transgenes in transgenic mice, Nucleic Acids Res 25 (1997) 1009–1014 [4] Fujiwara Y., Miwa M., Takahashi R.I., Kodaira K., Hirabayashi ... representation of the original and modified BACs and RFLP analyses A: Schematic representation of the 160 kb goat BAC41 insert Localisation of the transcription unit of the two genes are indicated by arrows...

Ngày tải lên: 14/08/2014, 13:22

... be able to read the same material as wealthier ones (although creating access to the Internet is another matter [10]) This is particularly relevant in virology as many viruses have regional, rather ... declare that my institution holds or has applied for several United Stated and International patents based on technology developed in my laboratory These patents or patent applications cover a range ... reviewers have provided their feedback, the monitoring editor makes the final recommendation Managing Editor, David Sander will be available to assist authors with content and formatting issues...

Ngày tải lên: 18/06/2014, 22:20

... module for data simulation For our approach to succeed, an Excel-VBA(visual basic for application) module according to the formulas of Cronbach's α (see Formula 1) and skewness (see Formula 2) was ... and Health Care Administration, Chia-Nan University of Pharmacy and Science, Tainan, Taiwan, 3School of Pharmacy, Kaohsiung Medical University, Kaohsiung, Taiwan, 4Assessment Research Center, ... The authors declare that they have no competing interests Authors' contributions WC, SJ and LF collected all data, generated the database, designed and performed the statistical analysis and...

Ngày tải lên: 20/06/2014, 16:20

... (Tužinský 1984; Papritz et al 1991) To evaluate the water balance of the examined forest stands, stemflow is an important factor – as already pointed out by Kantor (198 4a) , who reported that in the ... II – Waldklima und Wasserhaushalt Frankfurt, J D Sauerlanders Verlag: 365 PAPRITZ A et al., 1991 Schnelle Transportvorhange im Wurzelraum In: Lufthaushalt, Luftverschmutzung und Waldschaden in ... forest cover with optimum stand closure can very remarkably improve the situation in both surface and sub-surface discharge References BARNA M., 2004 Adaptation of European beech (Fagus sylvatica...

Ngày tải lên: 07/08/2014, 03:22

... et al., 200 7a) , water was taken from a municipal water filtering plant (Miyoshi, Hiroshima, Japan) prior to being treated for use as tap water The coliform bacteria and total bacterial counts in ... total bacterial count using the standard plate counting method One ml of appropriate dilutions of samples was inoculated in standard plate count agar (Nihon Pharmaceutical Co., Ltd., Tokyo, Japan) ... SC-CO2 treatment, whereas phosphatase (alkaline and acid) or naphthol-AS-BI-phosphohydrolase was slightly or a little inactivated Ishikawa et al (1996) reported that enzyme inactivation by the...

Ngày tải lên: 05/09/2013, 09:38

... carcinoma cells Oncogene 20, 2499–2513 Kanda N, Seno H, Konda Y, Marusawa H, Kanai M, Nakajima T, Kawashima T, Nanakin A, Sawabu T, Uenoyama Y et al (2004) STAT3 is constitutively activated and supports ... RHN(CH2)6CATTTCCCGTAATCGAAGATTACGGGAAATG-(CH2)3 NHR (hpST3dODN), which was derived from the seruminducible element of the human c-fos promoter, and RHN(CH2)6- CATTTCCCTTAAATCGAAGATTTAAG GGAAATG-(CH2)3NHR ... they are treated with IFN-c, we can tentatively conclude that it interacts with the activated forms of STAT3 and STAT1 The actions of STAT3 and STAT1 are highly entangled, they also have antagonistic...

Ngày tải lên: 18/02/2014, 08:20

... generate another manipulated images In these created images, hard tissue normal values were altered in at least two standard deviations Facial profile images were digitally manipulated in the anterior-posterior ... contradict psychoanalysts conclusions who state that a well developed mandible, with a strong chin is a secondary desirable sexual characteristic associated to a good facial attractiveness and ... with Class I or normal cephalometric values Using Dolphin Imaging and Graphics ® lateral cephalograms of subjects in natural posture were scanned Lateral cephalogram and profile images of each subject...

Ngày tải lên: 19/02/2014, 17:20

... experiments For characterization of the Calendula fatty acid conjugase, the yeast strain DTY10 -a2 (MATa, fas2D::LEU2, can1100, ura3-1, ade2-1, his3-11, his3-15) [28] was transformed with a plasmid ... two transformations are catalyzed by separate enzymes in this case remains to be determined In summary, the cryptic site of initial oxidation for an important plant fatty acid conjugase-mediated ... converts 11(Z)- tetradecenoate to 10(E),12(E)-tetradecadienoate by initial H-abstraction at C10 and 11(E)-tetradecenoate to 9(Z),11(E)-tetradecadienoate by initial oxidative attack at C9 [39] Whether...

Ngày tải lên: 08/03/2014, 09:20

... pGL40: 5¢-GACGCCGGTGA AGAATCAGGGTGCGTG-3¢, OL418 to generate pGL41: 5¢-CGAACGGGCACCTGTACACGGAGGACAGC-3¢ and OL420 to generate pGL42: 5¢-GCTGCGATGACA TGAACGATGGTTGCGACGGCGGGCTGATGC-3¢ These mutant constructs ... kDa The antiCPB serum recognized CPB isoenzymes that migrated as a major band with a molecular mass of 27 kDa and a minor band of molecular mass 26 kDa in cell lysates of stationary phase promastigotes ... CPB2.8 has Asn60, Asp61 and Asp64 whereas CPB3 has Asp60, Asn61 and Ser64 Interestingly, CPB18, which also has Asp60, Asn61 and Ser64 but also Tyr84 and Asn18 instead of the His84 and Asp18 in...

Ngày tải lên: 23/03/2014, 13:20

... Results and discussion To investigate the appropriate calcinations temperature for the transformation of the precursor to ZnO, the thermal analysis in air atmosphere was conducted Typical TGA/DTA plots ... increase the contact area between the catalysts and organic dyes Moreover, the gap formed by the adjacent nanosheets would enhance the absorption of exciting light and promote the photocatalytic activities ... photodegradation of MO as a function of irradiation time for the P0 and S0 samples As clearly shown, after irradiation for 100 min, the photocatalytic degradation of MO on S0 is 80% In fact, we have discussed...

Ngày tải lên: 06/05/2014, 13:26

... should also be evaporated at the converting temperatures of 1,300–1,400 °C And the evaporated aluminum can react with alumina nanowires, and may result in the formation of highly-active Al2O nanowires, ... with a uniform diameter and a pore interval Its average pore diameter and interval are *60 and 120 nm, respectively Significantly, a simple chemical etching of the porous alumina film in NaOH solution ... expressed as follows: Al2 O3 ðnanowireÞ þ 4Al ¼ 3Al2 OðnanowireÞ: And then the following reaction can take place: Al2 OðnanowireÞ þ 2NH3 ¼ 2AlNðnanowireÞ þ H2 O þ 2H2 : As a result, the Al2O3 nanowires...

Ngày tải lên: 21/06/2014, 20:20

... 5'-cgccaacatagaccaccttttc) and CCR5 (forward: 5'-caaaaagaaggtcttcattacacc and reverse: 5'-cttgctcgctcgggagcctc) (IDT, Coralsville, IA) were used to determine transcript levels while GAPDH (forward: ... internal control A secondary antibody, goat antirabbit IgG conjugated with alkaline phophatase (Promega, Madison, WI), was then added An alkaline phophatase substrate reagent, Western Blue (Promega), ... was used to visualize the bands RT-PCR Total RNA was extracted from non-transduced and transduced cells Primers specific for CXCR4 (forward: 5'-ggaggggatcagtatatacacttc and reverse: 5'-cgccaacatagaccaccttttc)...

Ngày tải lên: 10/08/2014, 05:20

... range Routine blood tests, erect chest and abdominal Xrays were unremarkable A provisional diagnosis of acute appendicitis was made and initial management included intravenous fluid resuscitation ... normal appendix was identified during laparoscopic examination of the abdomen An inflammatory mass was seen with turbid fluid collection in the pelvic area on laparoscopy The inflammatory mass ... Radiological as well as clinical findings aid clinicians in diagnosing this congenital anomaly Perforation of Meckel's diverticulum caused by a chicken bone is a very rare complication and may lead to a...

Ngày tải lên: 11/08/2014, 19:21

... clinical settings [3] Most of the studies evaluating NGAL as a predictor of AKI used a research-based ELISA assay The availability of a standardized clinical platform for NGAL measurement would make ... Devarajan P, Schlattmann P, Haase-Fielitz A: Accuracy of neutrophil gelatinase-associated lipocalin (NGAL) in diagnosis and prognosis in acute kidney injury: a systematic review and meta-analysis ... Hoste EA, Clermont G, Kersten A, Venkataraman R, Angus DC, De Bacquer D, Kellum JA: RIFLE criteria for acute kidney injury are associated with hospital mortality in critically ill patients: a cohort...

Ngày tải lên: 13/08/2014, 20:22

... are available A method for defining and comparing manual socket modifications quantitatively was developed by Lemaire et al [17] and integrated into a CAD software package The numerical comparison ... et al [63] used a pneumatic indentation apparatus with a variable compressive force adjusted using a close-loop control 14 Vannah et al [47] used a pencil-like indentation probe with a pneumatically ... tissue was assigned an initial E value and an analysis was carried out By comparing the FE analysis results with the experimental indentation depths, an estimation of Young’s modulus was obtained...

Ngày tải lên: 09/10/2015, 11:24