a real pain in the neck

... despite being given top compensation The mai-baap manager The Indian manager has a unique role to play, that of mai-baap (mother-father, that is, parents) Many team members also expect the manager ... issues The information processing roles are increasingly becoming more important as the amount of information and the mode of information have changed and has been changing rapidly since the Internet ... situation has many influences and dilemmas As a manager, you are destined to face these dilemmas on a daily basis Managerial decision-making depends on more than just the immediate facts of the...

Ngày tải lên: 23/03/2014, 13:20

... JF, Angtuaco EJ: Nasopharyngeal brain heterotopia: a cause of upper airway obstruction in infancy Laryngoscope 1984, 94:818-819 Patterson K, Kapur S, Chandra R: Nasal glioma and related brain ... sincere gratitude to all the Pediatric Surgery Unit staff at the Maternity And Child Teaching Hospital, Al-Qadisiya, Iraq, for their assistance Thanks also go to Dr Luaay E Alkhury (pathologist), ... deviation of the left mandible and masticator muscles anteriorly The airway at the pharyngomucosal space was compressed and stenosed A CT scan of our patient’s brain and neck showed a large heterogeneous...

Ngày tải lên: 10/08/2014, 23:21

... of the subclavian artery above the clavicle (Fig 3A) Simultaneous exposure of the brachial artery in the antecubital fossa was performed and a size Fogarty embolectomy catheter passed distally ... limb ischaemia [4,5,9] Pseudoaneurysm formation of the axillary artery is rare following blunt and penetrating trauma to the shoulder, often presenting late as a pulsatile mass rather than acute ... Yagubyan M, Panneton JM: Axillary artery injury from humeral neck fracture: A rare but disabling traumatic event Vasc Endovascular Surgery 2004, 38:175-184 Husain AK, Khandeparkar JM, Tendolkar AG,...

Ngày tải lên: 11/08/2014, 21:22

... Streptavadin (LSAB kit, DAKO) for 60 min, and further incubated with hydrogen-peroxidasediaminobenzidine (H2O2-DAB) to visualize the PCNA-positive cells Finally, they were counterstained with Mayer’s ... daily for 14 and 28 days Tumor areas were measured every days using a caliper, and the tumor area was calculated according to the formula: tumor volume (mm3) = d2 x D/2, where d and D were the ... compounds including lunasin and lectins that were shown to induce apoptosis in malignant cells [13] As CKBM contains these compounds, this would partially explain why it inhibits tumor growth in the...

Ngày tải lên: 03/11/2012, 09:54

... identifying the areas that discharge high pollutant loading into receiving waters METHODS Our area of interest was Marina del Rey and its vicinity in the Santa Monica Bay Watershed Santa Monica Bay ... were classified as transportation land use in the SCAG data and USGS classification system Vegetated areas inside the institutional areas were also identified as low pollutant loading areas, which ... with official land used data obtained from SCAG land use data The pollutant loading maps of all water quality parameters show that the low pollutant emitting areas correspond to open land use due...

Ngày tải lên: 05/09/2013, 09:08

... tape library The ability to integrate Real Audio with other HTML based materials RA sound clips are intrinsically motivating as the materials themselves are of interest to the students The range ... environmental issues, allows visitors to download any information from their site They have a daily radio program that lasts about a minute and a half A teacher or administrator can easily download dozens ... Classroom Real Audio in the Classroom The first step in using Real Audio is to download a free version or purchase RA at http://www .real. com/products/player/get.html After installing the program, begin...

Ngày tải lên: 06/09/2013, 10:10

... and making you want to the activity again, as soon as possible You get the positive reinforcement again, and again, and again, in a constant cycle of positive reinforcement, and soon you’re addicted ... inspiration in what others have done, you get ideas, you gather the raw materials for creating But consuming and communicating aren’t creating They aid creating, they lay the groundwork, but at some point ... general idea Again, start with half a day or a day — something manageable Do it once a week, and gradually expand the time you spend on the cleanse Reducing the Stream If you’ve done the cleanse,...

Ngày tải lên: 05/01/2014, 15:25

... branding, and means that rather than broadcasting messages to audiences and target groups, in the era of social 10 web that we live in today, branding and marketing is about participating in ... fram att utmaningen ligger i att vara relevant i sociala medier och i alla andra kommunikationskanaler, vilket handlar om att hitta den räta balansen mellan att presentera intressant material ... managing the brand portfolio The traditional definition of a brand used in brand management literature was formulated by the American Marketing Association in 1960 and identifies a brand as a kind...

Ngày tải lên: 18/02/2014, 08:20

... estimated by the Whiteman Alcian blue binding technique [28,29], using chondroitin sulfate as standard The assay was adapted to the estimation of GAG in more dilute samples by increasing the aliquot ... 269) Table Glycosaminoglycan analysis and calcium measurements of the water-soluble matrix, the EDTA-soluble matrix and the EDTA-insoluble matrix of Pinctada maxima nacre Sulfated and nonsulfated ... (6.5%) Thus, the alanine and glycine Fig Anion exchange-HPLC elution profiles of the water-soluble matrix (A) and the EDTA-soluble matrix (B) of Pinctada maxima nacre Samples (55 lL) containing 400...

Ngày tải lên: 21/02/2014, 01:21

... Fig 3A showing only the rates obtained in the absence of a Du In this case, the impairment of the ATP synthesis rates in the mutant was higher than twofold, especially in the low DpH range Again, ... concentration in each sample was measured in a luminometer (LKB 1250) with the ATP-Monitoring Kit (Bioorbit) The small amount of ATP synthesized in the dark (due to the adenylate kinase reaction) was ... mutation aE210K was introduced into the atp2 operon of Rb capsulatus, containing the F0 genes, cloned in an E coli strain The mutated operon was then transferred into a broad-host-range vector and the...

Ngày tải lên: 21/02/2014, 03:20

... at Metz In the meantime we taught him, at the same place, the manual of arms and Infantry tactics which had been introduced into the army after he was graduated at the Military Academy In practical ... to chaparral | | Page 20 relinguished changed to relinquished | | Page 21 chapparal changed to chaparral | | Page 22 chapparal changed to chaparral | | Page 27 chapparal changed to chaparral | ... supervising the construction of batteries against Chapultepec I was placed in charge of Battery No 1, on the Tacubaya road, against the southern face of the Castle; and Lieutenant McClellan in charge...

Ngày tải lên: 21/02/2014, 08:20

... for parents to support the learning of languages other than English through a play based approach Contact the Playgroup Association for further information Maintaining the ... Association, Richmond, Victoria, Australia Nyakatawa, S and Siraj-Blatchford, I 1994, ‘Bilingualism, biculturalism and learning in Early Years Classrooms’, in Blackledge, A (Ed), Teaching bilingual ... • playing picture lotto, bingo and card games, using two languages or playing in a language other than English 11 Supporting Children Learning English as a Second Language in the Early Years...

Ngày tải lên: 24/02/2014, 18:20

... 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC ... 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ ... 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢...

Ngày tải lên: 07/03/2014, 12:20

... particularly in the regulated industries of financial services and internet gaming, has created a marked shortage in the supply of certain specialised skills within these industries These growing pains ... maintain themselves and the members of their family without recourse to the social assistance system in Malta; iv reside in accommodation regarded as normal for a comparable family in Malta and ... bring in a marketing/sales person at the beginning? A: We find the reality is that the first 12 months of a startup is about getting the performance and operational infrastructure to work The...

Ngày tải lên: 07/03/2014, 16:20

... obtained by P1 transduction using strain CE1224 as the recipient and strains IQ85 and strain MM152, respectively, as donor strains To obtain strain CE1513, strain MM88 was used as Table Bacterial ... of the targeting signal is the parameter discriminating between SRP-dependent and SRP-independent pathways [14] On the other hand, in vitro cross-linking studies have revealed that the binding ... SDS/PAGE [32] and visualized by autoradiography In vitro transcription, translation, targeting and cross-linking analysis To generate truncated mRNA, plasmids (Table 1) encoding truncated nascent...

Ngày tải lên: 08/03/2014, 09:20

Ngày tải lên: 12/03/2014, 00:21

... based and comanagement institutions for sustainable coastal fisheries management in Southeast Asia Ocean & Coastal Management, Vol 27, No 3, pp 143 Ton That Phap, 2002 “Co-management in the planning ... exploiting, the provincial government and related agencies have promulgated many decrees and regulations in order to manage the lagoon’s resources The remarkable documents are indicated in the Table ... management, Hue, Vietnam Rivera, R .A, 1997 Re-inventing power and politics in coastal communities: community based and coastal resource management in the Philippines Marine Affairs Program, Dalhousie...

Ngày tải lên: 14/03/2014, 15:20

... cases It has been estimated to be under 1% in the USA, 4% in China, 6% in Italy, 7% in Japan, and 16% in Saudi Arabia [10] A Southeast Asian neighbor, Thailand, reported a 2.2% systemic TB involvement ... department as well as the eye exam of the participants He also drafted the manuscript VO examined participants suspected to have presumed ocular TB and was the one to confirm a patient as having ... would assist in the diagnosis of presumed or confirmed intraocular TB so that anti-tuberculous therapy (ATT) can be initiated on a rational basis Ocular TB has always been considered rare, yet...

Ngày tải lên: 15/03/2014, 03:20

... that the PX domain of p47phox binds intramolecularly to the SH3 domain in the same protein, and that this intramolecular interaction suppresses the lipid-binding activity of the PX domain in the ... domains, suggesting that the PX domain could bind to an SH3 domain of FAD49 To test whether the PX domain could interact with an SH3 domain in FAD49, we performed in vitro binding assays using ... (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions The total RNA was converted to single-stranded cDNA using a random primer and ReverTra Ace (Toyobo, Osaka, Japan) The...

Ngày tải lên: 16/03/2014, 04:20