a phenomenological approach to clinical sociology

... examined by subcostal views besides the cardiac chambers are:• Inferior vena cava • Hepatic veins • Azygous and anomalous pulmonary veins • Abdominal aorta and its branchesThe four cardiac chambers, ... and an electrocardiographic tracing • The examination of an adult patient usually begins with a depth of 20–25 cm and a wide sector (90°) This also gives an idea about any unusual extracardiac ... research has shown applicability of a lot of echocardiographic knowledge and information in day-to-day evidence-based medicine Quantitative and semi-quantitative protocols are gaining ground because

Ngày tải lên: 26/05/2017, 22:11

... bradycardia and tachycardia have been Category by Label A Transclival C Transtentorial (Uncal) D Transtentorial “Upward” E Tonsillar F Transtentorial Central B Subfalcine Dependent on area ... postoperative intracranial hemorrhage) • Traumatic hemorrhage(epidural hematoma, acute subdural hematoma) • Acute cerebral edema (acute hyponatremia, hepatic coma, Reye’s syndrome, cerebral ... [36] Mannitol can cross into the inter-stitial space and may worsen brain edema Hypertonic saline may also decrease ICP aft er a patient has become refrac-tory to mannitol Th e use of large amounts

Ngày tải lên: 20/01/2020, 15:08

... Kristiansen SB, et al Validation of myocardial acceleration during isovolumic contraction as 41 Kittipovanonth M, Bellavia D, Chandrasekaran K, raga HR, Abraham TP, Pellikka PA Doppler myocardial ... fractional area change represents the ratio of systolic area change to diastolic RV area It is measured in the four-chamber view and can be incorporated systematically into the basic echocardio-graphic ... cardiomyocyte, myocardial or LV physiology, and are invariably accessible to noninvasive evaluation Diastolic dysfunction is an abnormality that causes impaired relaxation (and decreased ventricular suction),

Ngày tải lên: 22/01/2020, 07:44

... hypertension, diabetes and left ventricular hypertrophy as also with aging, systolic elastance remains unaffected or may actually increase, and diastolic elastance decreases, which can be studied and assessed ... phases uniquely reflect cardiomyocyte, myocardial or LV physiology, and are invariably accessible to noninvasive evaluation Diastolic dysfunction is an abnormality that causes impaired relaxation ... interventricular septum Average displacement of a myocardial wall is approximately 8 mm with a base-to-apex gradient Note that the apical segment (red curve) is nearly stationary while the basal segment

Ngày tải lên: 23/01/2020, 11:10

... https://getbooksolutions.com/download/test-bank-for-mastering- competencies-in-family-therapy-a-practical-approach-to-theory-and-clinical-case-documentation-2nd-edition/ Mastering Competencies in Family Therapy Chapter ... therapists target change in therapy? a Help the family to create a new game or dance without symptoms b Help the family to create a problem-free family homeostasis c Help the family to develop a ... a 1) Problem stage, 2) social stage, 3) interaction stage, 4) goal-setting stage, and 5) task-setting stage b 1) Social stage, 2) problem stage, 3) interaction stage, 4) goal-setting stage, and

Ngày tải lên: 02/03/2019, 08:23

... principal investigators are Harry Thie and Margaret Harrell Com-ments are welcome and may be addressed to Harry Thie at harry_thie @rand.org and to Margaret Harrell at margaret_harrell@rand.org.For ... Schirmer, and Nelson Lim, Framing a Strategic Approach for Joint Officer Management, Santa Monica, Calif.: RAND Corporation, MG-306-OSD, 2005. 2 Harry J Thie, Margaret C Harrell, Sheila Nataraj Kirby, ... Factors Retained in the Factor Analysis Procedure 42 3.7 Rotated Factors and Variable Loadings 43 3.8 Means and Standard Deviations of Rotated Factor Scores, by JDAL Category 46 Trang

Ngày tải lên: 06/03/2014, 21:20

... ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R ... name Sequence (5¢- to 3¢) OMCA-KO-F OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT ... omcA– mutant, and omcA (lane 7), omcB (lane 8), mtrA (lane 9) and mtrB (lane 10) in the omcB– mutant MR-1R was used as a positive control to display omcA (lane 1) and omcB (lane 6) DNA standards

Ngày tải lên: 07/03/2014, 09:20

... Inderjeet Mani 2001 Automatic Summarization Nat-ural Language Processing, John Benjamins Publish-ing Company. Rada Mihalcea 2005 Language independent extrac-tive summarization In AAAI’05: Proceedings ... several summary quality metrics Trang 9We are grateful to Michael Elhadad and Galina Volk from Ben-Gurion University for providing the ROUGE toolkit adapted to the Hebrew alpha-bet, and to Slava ... (2000) used a GA to learn an optimized set of parame-ters for a keyword extractor embedded in the Ex-tractor tool.3 Or˘asan et al (2000) enhanced the preference-based anaphora resolution algorithms

Ngày tải lên: 07/03/2014, 22:20

... is happening tothe environment As a practical matter, data toconstruct indicators is usually most available forpressure indicators and sparsest for responseindicators For practicality's sake, ... restricted to indicators that can support national or international decisionmaking These in-dicators can guide national decisionmaking and fo-cus top-level policy attention Those gauging national performance ... the diagnosis of the situation and mak-ing progress or stalemate obvious to all Envi-Sustainability involves—at a acting economic, social, and environmental fac-tors Progress toward sustainability

Ngày tải lên: 15/03/2014, 16:20

... Trang 1[Mechanical Translation, Vol.6, November 1961] A New Approach to the Mechanical Syntactic Analysis of Russian by Ida Rhodes*, National Bureau of Standards This paper categorically ... considering a word- to-word conversion as a translation A true translation is unattainable, even by the human agent, let alone by mechanical means However, a crude practical translation is probably achievable ... a sample of the translator’s art as a good translation is akin to charac- terizing a case of mayhem as a good crime: in both instances the adjective is incongruous If, as a crowning handicap,

Ngày tải lên: 16/03/2014, 19:20

... 3.4 Adaptiveness of Parameters Obtaining the labeled data needed for parameter learning entails a nontrivial manual effort Ideally, we would like to learn the parameters of MaxPaths in one domain, ... Mitton, 2010) As a sim-ple examsim-ple, if we want to avoid maintaining a manually-crafted dictionary to accommodate the wealth of new terms introduced every day (e.g., ipod andipad), we may ... weight(e)def= a s · #splits(e) Note that a m and a s are negative, as they penalize for merges and splits, respectively Again, in our implementations, we learned a m and a s by means of SVM Recall that topPathsD(s)

Ngày tải lên: 17/03/2014, 00:20

... statistical verb lexicon In EMNLP Jan Hajiˇ , Massimiliano Ciaramita, Richard Johansc son, Daisuke Kawahara, Maria Ant` nia Mart´, Llu´s o ı ı M` rquez, Adam Meyers, Joakim Nivre, Sebastian a ˇe a Pad´ ... cross-lingual semantic role annotation In ACL Dekai Wu and Pascale Fung 2009 Semantic roles for SMT: A hybrid two-pass model In NAACL Dekai Wu, Marianna Apidianaki, Marine Carpuat, and Lucia Specia, ... parameter T is chosen empirically Empirical Evaluation 7.1 Data and Evaluation We keep the general setup of (Lang and Lapata, 2011a), to evaluate our models and compare them to the current state

Ngày tải lên: 17/03/2014, 22:20

... elektrostaattisen attraktion vaikutusta. Märän paperin lujuuden parantuminen korkeassa pH:ssa adsorboidun kitosaanin ansiosta yhdistettiin selluloosapintojen välisen adheesion kasvuun kitosaanin ... experimental data had indicated that plasticization by water was essential in regard to tensile properties of polysaccharide materials Paper. .. there is a crucial process stage in regard to ... Yhdistelmäväitöskirja (yhteenveto + erillisartikkelit) Tiedekunta Kemian ja materiaalitieteiden tiedekunta Laitos Puunjalostustekniikan laitos Tutkimusala Puunjalostuksen kemia Vastaväittäjä(t)

Ngày tải lên: 18/03/2014, 02:20

... program, taking care of such tasks as transferring command-line arguments (see Chapter 5) to main and main’s return value back to the operating system We are finally ready to treat program ... Program There is no faster way to crash a program than to make a mistake with memory (Actually, this statement overstates the case: a program need not crash immediately after an erroneous ... chapter covers both for two reasons First, manipulating... the addresses are the particular values that they are later Each cell is annotated with its associated variable and the type of that

Ngày tải lên: 19/03/2014, 14:05

... a top-down approach to graphing attacks which allows a more systemic analysis The cost or 11 A N ANALYSIS 12 OF E - BANKING VULNERABILITIES difficulty of attacks can also be propagated ... eBay Toolbar [64] is mainly aimed at preventing phishing of eBay and PayPal, the two main eBay brands These are both targets of a lot of phishing attacks, due to their market share The eBay ... VoIP and war-dialling techniques an... the same as a low per-attack cost Some attackers may not be able to ever afford the initial outlay (particularly if it is not cost, but 2.4 ATTACK TREES

Ngày tải lên: 23/03/2014, 03:20

... Library of Congress Cataloging-in-Publkation Data Thomas, Sandra P, Listening to patients : a phenomenological approach to nursing / Sandra P Thomas, Howard R Pollio p cm Includes bibliographical ... administrators to even approach "their" patients to explain a study Despite provision of written and verbal explanations about phenomenological interviewing and assurances that (a) participation ... the man as a nurse and Ginger as a physician, whereas still other reactions identify the man as a nurse and Ginger as a patient You don't have to be a philosopher of language or a communications...

Ngày tải lên: 16/10/2013, 11:15

... able to create meaningful data valid in large scale analyses (across herds and veterinary practices) Such veterinarians would generally want to focus on possibilities for across-herd data analyses ... scores as a 'diagnostic tool' related to each individual treatment decision rather than being part of a collaborative data collection For example, they could add rectal temperature and other parameters ... provides insight into potential errors (bias and random error) related to data based on clinical examina- Page of 10 (page number not for citation purposes) Acta Veterinaria Scandinavica 2009, 51:36...

Ngày tải lên: 25/10/2012, 10:45

... However, Feynman soon learned that there was a great obstacle to this delayed action-at -a- distance theory: namely, if a radiating electron, say in an atom or an antenna, were not acted upon at all by ... xn (a) and which leaves the action invariant (for example, the transformation may be a rotation) The transformation is to contain a parameter, a, and is to be a continuous function of a For a equal ... gives probably the most fundacorresponds to e mental quantum analogue for the classical Lagrangian function It is preferable for the sake of analogy to consider the classical Lagrangian as a function...

Ngày tải lên: 06/11/2012, 11:21

... time available/ in the available time.(1) We have to exploit all available potential/ all potential available in our country (2) As we know that when changing the position of adjective available ... should be washed everyday Nguyễn Thị Nga K 1 1A 19 Graduation paper 2.2.5 Exclamatory adjective sentence An adjective as head of an adjective phrase or as its sole realization can be an exclamation: ... up to now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central...

Ngày tải lên: 10/04/2013, 14:46

... team The database analysts and the programmers are unable to agree on the proper ways to pass information back and forth between the interface and the database, and the requirements analysts and ... software packages), hardware and software implementation (implementing new computers or software), database management and revision (ensuring proper data storage and access), hardware and software ... Project managers usually employ a Responsibility Assignment Matrix (RAM) such as the sample in Table (PMI, 2000), and OD scholars have advocated similar approaches in teambuilding and organizational...

Ngày tải lên: 24/10/2013, 08:20