a novel approach to semantic

Báo cáo hóa học: " Research Article A Novel Approach to Detect Network Attacks Using G-HMM-Based Temporal Relations between Internet Protocol Packets" pot

Báo cáo hóa học: " Research Article A Novel Approach to Detect Network Attacks Using G-HMM-Based Temporal Relations between Internet Protocol Packets" pot

... the total number of normal data The false negative rate is defined as the total number of attack data that were incorrectly classified as normal traffic divided by the total number of attack data 7.1 ... learning dataset with above-described dataset This dataset had 100,000 normal packets and 1,000 to 1,500 abnormal packets for training and evaluating each In the case of unsupervised learning algorithms ... because each data value is too small or too few points are assigned to a cluster center due to a bad initialization of the means In case of internet traffic, this problem can also occur because each

Ngày tải lên: 21/06/2014, 05:20

14 502 0
Báo cáo hóa học: "Research Article A Novel Approach to the Design of Oversampling Low-Delay Complex-Modulated Filter Bank Pairs" doc

Báo cáo hóa học: "Research Article A Novel Approach to the Design of Oversampling Low-Delay Complex-Modulated Filter Bank Pairs" doc

... based on the Remez exchange algorithm With the mentioned approaches a filter group EURASIP Journal on Advances in Signal Processing delay can always be obtained that ranges below the group delay ... that the tolerance mask is not always touched by the magnitude response In some regions the magnitude response ranges far below the allowed attenuation, which can be traced back to the fact that ... yield a convex optimization problem 3.2.1 Passband Narrow-band low-pass filters usually not exhibit a distinctive passband In order to obtain a narrowband low-pass filters it is sufficient to ask for

Ngày tải lên: 21/06/2014, 19:20

13 626 0
Báo cáo hóa học: " Research Article RRES: A Novel Approach to the Partitioning Problem for a Typical Subset of System Graphs" potx

Báo cáo hóa học: " Research Article RRES: A Novel Approach to the Partitioning Problem for a Typical Subset of System Graphs" potx

... available silicon area (hardware capacity), B. Knerr et al. 3 memory (software capacity), and latency as a timing con- straint. The global criticality/local phase (GCLP) algorithm is basically ... (b) according to ASAP and ALAP schedule. sequential device. It has to be stated that T min and T total are lower and upper bounds since their exact calculation in most cases is a hard optimisation ... there are about as many different cost functions as there are research groups, all of the referred to approaches in Section 2 consider time and area as counteracting optimisa- tiongoals.Ascanbeseenin(6),

Ngày tải lên: 22/06/2014, 06:20

13 320 0
Báo cáo y học: "A novel approach to measure the contribution of matrix metalloproteinase in the overall net proteolytic activity present in synovial fluids of patients with arthritis" pptx

Báo cáo y học: "A novel approach to measure the contribution of matrix metalloproteinase in the overall net proteolytic activity present in synovial fluids of patients with arthritis" pptx

... metalloproteinase 9 (96-kd gelatinase B) in human rheumatoid arthritis. Arthritis Rheum 1996, 39:1576-1587. 3. Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases ... La Fondation Armand-Frappier and the Canadian Arthritis Network. References 1. Momohara S, Kashiwazaki S, Inoue K, Saito S, Nakagawa T: Elastase from polymorphonuclear leukocyte in articular ... spondylitis and reactive arthritis. A patient with features of more than one rheumatic disease (e.g. OA and crystal-induced arthritis) was classified as having the disease that clinically predominated at

Ngày tải lên: 09/08/2014, 08:22

10 496 0
Báo cáo y học: "A novel approach to modelling water transport and drug diffusion through the stratum corneum" pdf

Báo cáo y học: "A novel approach to modelling water transport and drug diffusion through the stratum corneum" pdf

... this comparison, we are able to address the head pressure contours as part of a family of solutions Thus, quantitative arbitrary values of pressure always result in the same qualitative features ... through appendages such as hair follicles and sweat glands Although the relative importance of each is still not clear, there is a general consensus that the intercellular pathway plays a major ... Zurich, Mattenstrasse 26, 4058 Basel, Switzerland Department of Earth Sciences, Simon Fraser University, Burnaby, BC, V 5A 1S6, Canada Abstract Background: The potential of using skin as an alternative

Ngày tải lên: 13/08/2014, 16:20

25 373 0
Báo cáo y học: "A novel approach to identifying regulatory motifs in distantly related genomes" pps

Báo cáo y học: "A novel approach to identifying regulatory motifs in distantly related genomes" pps

... the pax6 dataset Block Consensus sequence and possible binding sites pax6 1.1 (UCSC) CTTAATGATGAGAGATCTTTCCGCTCATTGCCCATTCAAATACAATTGTAGATCGAAGCCGGCCTT GTCAsGTTGAGAAAAAGTGAATTTCTAACATCCAGGACGTGCCTGTCTACT ... (0.930) pax6 2.4 (-) GGTTGCTTTCAGGTwTAATTAACTTTGAACAACAAATA Nkx2-5, M00241, CWTAATTG: 16-23 - (0.902) pax6 3.1 (UCSC) TTGTAATTACTGCCCTTCATGTGGTCCGGTGCCTTGAACCATCTTTAATTAAAAGCATAATTAAGG AML- 1a, M00271, ... (0.948) GATA-3, M00077, NNGATARNG: 4-12 - (0.917) SRY, M00148, AAACWAM: 7-13 + (0.917) pax6 1.6 (UCSC) CAsGTTGAGAAAAAGTGAATTTCTAACATCCAGGACGTGCCTGTCTACTTTCAGw GAATTGCATCCAATCACCCCCAGGGAATTCnGCTAATGTCTCC

Ngày tải lên: 14/08/2014, 16:20

18 390 0
Probiotics as a novel approach to modulate incretins, insulin secretion and risk factors of type 2 diabetes and complications

Probiotics as a novel approach to modulate incretins, insulin secretion and risk factors of type 2 diabetes and complications

... Lebensmittelwissenschaften (IEL) an der Landwirtschaftlichen Fakultät der Rheinischen Friedrich-Wilhelm-Universität Bonn Probiotics as a novel approach to modulate incretins, insulin secretion and risk factors ... Staunen ist der Anfang der Erkenntnis Platon (ca 427 v.Chr - 347 v.Chr.) Summary Background and Aim: Ingestion of probiotics can modify gut microbiota and alter insulin resistance and diabetes development ... that daily intake of Lactobacillus (L.) reuteri increases insulin sensitivity by changing cytokine release and insulin secretion via modulation of glucagon-like peptide (GLP-1, GLP-2) release

Ngày tải lên: 19/11/2015, 16:47

105 333 0
The breakfast club for 40 somethings a novel approach to unlearning money and reinventing your life

The breakfast club for 40 somethings a novel approach to unlearning money and reinventing your life

... experience to truly understand what brings you happiness and what really matters When you have clarity around how you want to live long term, you can then start to make a plan toward it Without that ... she had any more time to check Brad out Jasper was fit and he had always been athletic, but Brad Malone took that to a whole new level The guy was Hollywood fit, and the less Jayne saw of that ... seem, and Karen and Russ face challenges that are familiar to so many of us — juggling parenting, ageing parents, money pressures and work hassles Here are their vital stats: married for 17 years

Ngày tải lên: 03/01/2020, 10:40

117 77 0
A novel approach to monitoring the efficacy of anti-tumor treatments in animal models: Combining functional MRI and texture analysis

A novel approach to monitoring the efficacy of anti-tumor treatments in animal models: Combining functional MRI and texture analysis

... data, and writing manuscript Availability of data and materials The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request Authors’ ... the anti-angiogenic activity of bevacizumab compared with that of paclitaxel To ensure the accuracy of our research, we adopted an alternative new technique, texture analysis, to analyze and ... Padhani AR, Miles KA Multiparametric imaging of tumor response to therapy Radiology 2010;256:348–64 26 Yanagisawa M, et al Bevacizumab improves the delivery and efficacy of paclitaxel Anti-Cancer

Ngày tải lên: 03/07/2020, 01:25

12 41 0
Synergisms of genome and metabolism stabilizing antitumor therapy (GMSAT) in human breast and colon cancer cell lines: A novel approach to screen for synergism

Synergisms of genome and metabolism stabilizing antitumor therapy (GMSAT) in human breast and colon cancer cell lines: A novel approach to screen for synergism

... https://www.cancer.org/content/dam/cancer-org/research/cancer-factsand-statistics/annual-cancer-facts-and-figures/2018/cancer-facts-andfigures-2018.pdf Güth U, Magaton I, Jane D, Fisher R, Schötzau A, Vetter M Primary and secondary distant metastatic breast ... read and approved the manuscript Funding Jonas Parczyk received a 6-month scholarship by the Berlin Institute of Health during his doctoral thesis Availability of data and materials All data ... combinatory approaches are needed An example for such a concept is CUSP9 where multiple drugs that are approved for non-cancer indications are combined as a treatment approach for recurrent glioblastoma

Ngày tải lên: 06/08/2020, 05:17

14 29 0
TRAIL-induced programmed necrosis as a novel approach to eliminate tumor cells

TRAIL-induced programmed necrosis as a novel approach to eliminate tumor cells

... (even a small) apoptotic caspase activation would ultimately translate into activation of caspase-3 and thus into an accumulation of cleavage fragments of PARP-1 and caspase-3 However, this was ... Kumar A, Eby MT, Sinha S, Jasmin A, Chaudhary PM: The ectodermal dysplasia receptor activates the nuclear factor-kappaB, JNK, and cell death pathways and binds to ectodysplasin A J Biol Chem 2001, ... Stephan Philipp1, Parvin Davarnia1, Supandi Winoto-Morbach1, Christian Röder2, Christoph Arenz3, Anna Trauzold2, Dieter Kabelitz1, Stefan Schütze1, Holger Kalthoff2 and Dieter Adam1* Abstract Background:

Ngày tải lên: 05/11/2020, 01:07

14 16 0
A Novel Approach to the Part Orientation Problem for Robotic Asse

A Novel Approach to the Part Orientation Problem for Robotic Asse

... assembly tasks take place along a non-vertical axis To account for non-vertical axis assembly, parts must be fed in a proper orientation to allow for correct assembly Parts feeders and specialized ... to aid in part manipulation The end-effector can be designed as part of the overall system as opposed to a separate entity • A dynamic analysis was completed to determine the required resistance ... Applications Brian James Slaboch Marquette University Recommended Citation Slaboch, Brian James, "A Novel Approach to the Part Orientation Problem for Robotic Assembly Applications" (2011) Master's

Ngày tải lên: 25/10/2022, 03:18

79 4 0
protein rethreading a novel approach to protein design

protein rethreading a novel approach to protein design

... www.nature.com/scientificreports OPEN Protein rethreading: A novel approach to protein design Sayeh Agah*, Sandra Poulos*, Austin Yu, Iga Kucharska & Salem Faham received: 08 October 2015 accepted: ... Protein topology diagrams were prepared with TopDraw31 Data collection and refinement statistics are shown in Table 1 The data was complete to 1.7 Å, but significant data was measured to higher ... of a cryo protectant since the crystallization condition had a high concentration of PEG Data collection was carried out at the 22-ID beamline at the Advanced Photon Source (Argonne National Laboratory)

Ngày tải lên: 04/12/2022, 16:06

11 9 0
A novel approach to automatic detection

A novel approach to automatic detection

... Committee Assoc Prof Dr Hasan Abdullah (BL), Assist Prof Dr Alias Abdulrahman (MAL), Assist Prof Dr Abdullah Aksu, (TR); Prof Dr Hasan Atar (TR), Prof Dr Lale Balas (TR), Prof Dr Levent Bat (TR), Assoc ... Sci and Softw Eng 2(1):1-8 Samal, A and Iyengar, P .A (1992) Automatic recognition and analysis of human faces and facial expressions: a survey, Pattern Recognition, 25 (1): 65-77 Savran,N A. , Dibeklioğlu, ... (Davies, 2012) and Fast (Jazayeri and Fraser, 2010) As these operators were developed to serve general purposes, when special kinds of data that have such small sizes as the human face are to be studied,

Ngày tải lên: 10/02/2023, 19:53

13 2 0
Báo cáo khoa học: "A Bayesian Approach to Unsupervised Semantic Role Induction" docx

Báo cáo khoa học: "A Bayesian Approach to Unsupervised Semantic Role Induction" docx

... cross-lingual semantic role annotation In ACL Dekai Wu and Pascale Fung 2009 Semantic roles for SMT: A hybrid two-pass model In NAACL Dekai Wu, Marianna Apidianaki, Marine Carpuat, and Lucia Specia, ... statistical verb lexicon In EMNLP Jan Hajiˇ , Massimiliano Ciaramita, Richard Johansc son, Daisuke Kawahara, Maria Ant` nia Mart´, Llu´s o ı ı M` rquez, Adam Meyers, Joakim Nivre, Sebastian a ˇe a Pad´ ... A Bayesian Approach to Unsupervised Semantic Role Induction Ivan Titov Alexandre Klementiev Saarland University Saarbră cken, Germany u {titov|aklement}@mmci.uni-saarland.de Abstract We

Ngày tải lên: 17/03/2014, 22:20

11 355 0
A novel role of hydrogen sulfide in wound healing and a new approach to wound dressing in rat model

A novel role of hydrogen sulfide in wound healing and a new approach to wound dressing in rat model

... inflammation) increased in wounded skin, and PAG administration significantly reduced MPO activity in wounded skin compared to non-treated animals Histological analysis also revealed that aggregated ... significantly accelerated the wound healing compared to control animals -6- Abbreviations: PAG: DL-propargylglycine BCA: β-cyano-L-alanine Ac-Na: Diclofenac Sodium Ac-S: S-diclofenac CSE: Cystathionine-γ-lyase ... to thank the colleagues in the cardiovascular research group in Dept Pharmacology and the staffs in Defense Medical and Environmental Research Institute; they made the Lab a wonderful workplace

Ngày tải lên: 26/09/2015, 09:39

80 431 0
College writing - A personal approach to academic writing

College writing - A personal approach to academic writing

... Cataloging-in-Publication Data Fulwiler, Toby, 1942– College writing : a personal approach to academic writing / Toby Fulwiler.—3rd ed. p. cm. Includes index. ISBN 0-86709-523-7 (acid-free paper) 1. English language—Rhetoric. ... include, what to omit, and the list goes on. There are, however, some things you can do to simplify this choice- making process and make it less daunting, more approachable. Whenever you sit down to ... One A WRITER’S CHOICES The reason, I think, I wait until the night before the paper is due, is that then I don’t have any choice and the prob- lem goes away. I mean, I stop thinking about all

Ngày tải lên: 18/12/2013, 17:33

253 498 0
Partnering: A New Approach to Sexual and Reproductive Health doc

Partnering: A New Approach to Sexual and Reproductive Health doc

... including marital rape and sexual abuse, and against violence towards women and girls as a human rights violation; and for programmes to encourage and enable men to adopt safe and ... sexual health is difficult to arrive at because human sexuality is varied, diverse and dynamic ICPD addressed sexual health as a notion that “implies a positive approach to ... and Prevention Project APHA American Public Health Association APPROPOP/PF Appui au Programme de Population/Planification Familiale ARH/SH Adolescent Reproductive Health and Sexual

Ngày tải lên: 05/03/2014, 16:20

196 509 0
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

... Nga – K 1 1A 30 Graduation paper Declaration Title: A new approach to semantic and syntactic functions of English adjectives A contrastive– analysis with their Vietnamese equivalents (Graduation ... stative or dynamic contrast, as it related to adjectives, is largely a semantic one, though as we have seen it also has syntactic implications. 2.2.2 Gradable and non- gradable adjectives According ... subject at most language universals. According to C. James (1980;19), C .A is a form of inter-language study and a central concern of applied linguistic. As a matter of fact, C .A has had much to...

Ngày tải lên: 10/04/2013, 14:46

44 1,8K 9
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

... of variation and bias in relation to monitoring of animal disease incidence on herd and national level, causal analysis on national level, as well as estimation of validated treatment criteria. Monitoring ... into potential errors (bias and random error) related to data based on clinical examina- Acta Veterinaria Scandinavica 2009, 51:36 http://www.actavetscand.com/content/51/1/36 Page 8 of 10 (page ... metritis' that relate to the quality of the data that are produced. We analyse and build &apos ;a model of understanding' based on DBL's observations and the indi- vidual veterinarians'...

Ngày tải lên: 25/10/2012, 10:45

10 589 0

Bạn có muốn tìm thêm với từ khóa:

w