... con- straints on the available silicon area (hardware capacity), B. Knerr et al. 3 memory (software capacity), and latency as a timing con- straint. The global criticality/local phase (GCLP) algorithm ... according to ASAP and ALAP schedule. sequential device. It has to be stated that T min and T total are lower and upper bounds since their exact calculation in most cases is a hard optimisation ... there are about as many different cost functions as there are research groups, all of the referred to approaches in Section 2 consider time and area as counteracting optimisa- tiongoals.Ascanbeseenin(6),
Ngày tải lên: 22/06/2014, 06:20
... La Fondation Armand-Frappier and the Canadian Arthritis Network. References 1. Momohara S, Kashiwazaki S, Inoue K, Saito S, Nakagawa T: Elastase from polymorphonuclear leukocyte in articular ... metalloproteinase 9 (96-kd gelatinase B) in human rheumatoid arthritis. Arthritis Rheum 1996, 39:1576-1587. 3. Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases ... microspheres, based upon a physical characteristic such as size and scattering, to develop a simple and reliable method that allows qualitative and quantitative measurements of specific enzymatic reaction
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "A novel approach to modelling water transport and drug diffusion through the stratum corneum" pdf
... Simon Fraser University, Burnaby, BC, V5A 1S6, Canada Abstract Background: The potential of using skin as an alternative path for systemicallyadministering active drugs has attracted considerable ... directions, as well as longitudinally Diffusion occurs along a concentration gradient, and may transport mass in a direction opposite to the fluid flow if concentration gradients are high enough ... Trang 1R E S E A R C H Open AccessA novel approach to modelling water transport and drug diffusion through the stratum corneum Tatiana T Marquez-Lago1,2*, Diana M Allen3*, Jenifer Thewalt4
Ngày tải lên: 13/08/2014, 16:20
Báo cáo y học: "A novel approach to identifying regulatory motifs in distantly related genomes" pps
... sequence and possible binding sites pax6 1.1 (UCSC) CTTAATGATGAGAGATCTTTCCGCTCATTGCCCATTCAAATACAATTGTAGATCGAAGCCGGCCTT GTCAsGTTGAGAAAAAGTGAATTTCTAACATCCAGGACGTGCCTGTCTACT *Minimal fragment for ... AAAAnTGTACTTTTTTAGTATTTACyT *HoxA5 (TTTAaTAaTTA), TTTAGTATTTA: 14-24 + CdxA, M00101, AWTWMTR: 16-22 - (0.979) SRY, M00148, AAACWAM: 7-13 - (0.928) Hoxb2 2.3 (UCSC) GTGTGTTCTAGTGAACATTTTCATATATATTTATTGGTTAT *Glucocorticoid ... found in Additional data file 1 and in [44] Because the motifs in these additional datasets have not been studied as extensively as those of the benchmark datasets, we cannot guarantee all detected
Ngày tải lên: 14/08/2014, 16:20
Probiotics as a novel approach to modulate incretins, insulin secretion and risk factors of type 2 diabetes and complications
... to measure LPS 39 1 H MRS for the determination of hepatic and muscular fat content 39 Lactobacillus reuteri capsules and placebo capsules 40 Statistical data analysis and power calculation ... over a period of two weeks lead to increased plasma GLP-1 and Peptide YY concentrations as well as decreased post prandial glucose concentrations in humans (Cani et al., 2009a) To date only one ... cell wall of gram-negative bacteria, in the peripheral blood are associated with low-grade inflammation (Caradonna et al., 2000; Cani et al., 2012; Cani and Delzenne, 2009c; Andreasen et al.,
Ngày tải lên: 19/11/2015, 16:47
The breakfast club for 40 somethings a novel approach to unlearning money and reinventing your life
... Shore, and he was great at being charming and always on call — which was what contributed to him being atotal nightmare as a husband He was always busy, always working weekends and neveraround And ... at work — and he had done that on a grand scale But, occasionally, he heard someone laugh, or smelt apple shampoo on a woman, and he was reminded of her — and it always made him smile Brad wondered ... family sat together and talked Sure, somedays the conversation was better than others, but it meant a lot to Karen and Russ tocheck in as a family Karen rushed to get the pasta on as she heard
Ngày tải lên: 03/01/2020, 10:40
A novel approach to monitoring the efficacy of anti-tumor treatments in animal models: Combining functional MRI and texture analysis
... Trang 1R E S E A R C H A R T I C L E Open AccessA novel approach to monitoring the efficacy of anti-tumor treatments in animal models: combining functional MRI and texture analysis Abstract Background: ... were ac-quired from the functional MRI and analyzed in SPSS 20.0 The data under paclitaxel monotherapy and com-bination therapy were compared with the control condi-tion by an analysis of variance ... multi-b-value DWI Pharmacokinetic parameters of CER (contrast enhancement ratio), Ktrans (transfer rate con-stant), Kep (reverse rate constant), Ve (extravascular extracellular volume fraction),
Ngày tải lên: 03/07/2020, 01:25
Synergisms of genome and metabolism stabilizing antitumor therapy (GMSAT) in human breast and colon cancer cell lines: A novel approach to screen for synergism
... doctoral thesis Availability of data and materials All data generated or analysed during this study are included in this published article and its supplementary information file (Additional file ... https://www.cancer.org/content/dam/cancer-org/research/cancer-factsand-statistics/annual-cancer-facts-and-figures/2018/cancer-facts-andfigures-2018.pdf Güth U, Magaton I, Jane D, Fisher R, Schötzau A, Vetter M Primary ... protocol for recurrent glioblastoma: aprepitant, artesunate, auranofin, captopril, celecoxib, disulfiram, itraconazole, ritonavir, sertraline augmenting continuous low dose temozolomide Oncotarget
Ngày tải lên: 06/08/2020, 05:17
TRAIL-induced programmed necrosis as a novel approach to eliminate tumor cells
... activation would ultimately translate into activation of caspase-3 and thus into an accumulation of cleavage fragments of PARP-1 and caspase-3 However, this was only detectable in the positive controls ... and S1d) Given that caspase-3 acts downstream of all other apoptotic caspases as the central effector caspase of both extrinsic and intrinsic apoptosis, any (even a small) apoptotic caspase activation ... chromatography plates were scanned and analyzed using the Molecular Dynamic Personal Densitometer SI Scanner control software (GE Healthcare, Munich, Germany) Clonogenic survival assays Assays
Ngày tải lên: 05/11/2020, 01:07
A Novel Approach to the Part Orientation Problem for Robotic Asse
... significant downtime and added cost Another option Trang 17is to attach a pneumatic rotary actuator to the end of a SCARA type robot toprovide an added DOF An example of a pneumatic rotary actuator ... It was thought that a similar idea could be used to stop the rotation of apivoting gripper The mechanical brake would be actuated using an additionalpneumatic actuator Lastly, a device was considered ... robotic assembly applications The SCARArobot shown in Fig 1.2 allows for translational motion as well as a rotation aboutthe z-axis.1 SCARA type robots work well for assembly tasks and pick and placeoperations
Ngày tải lên: 25/10/2022, 03:18
fugeprior a novel gene fusion prioritization algorithm based on accurate fusion structure analysis in cancer rna seq samples
... made The Creative Commons Public Domain Dedication waiver Trang 2can be considered a typical example of pathognomonicalterations Thus, their identification and characteriza-tion have been considered, ... Trang 1S O F T W A R E Open AccessFuGePrior: A novel gene fusion prioritization algorithm based on accurate fusion structure analysis in cancer RNA-seq samples Giulia Paciello*and Elisa Ficarra ... from a binary classification algorithm using gradient tree boosting The classifier is trained on a feature space of protein domain annotations and val-idated tumor fusions (A, second phase) Thus,
Ngày tải lên: 04/12/2022, 10:36
protein rethreading a novel approach to protein design
... addition of a cryo protectant since the crystal-lization condition had a high concentration of PEG Data collection was carried out at the 22-ID beamline at the Advanced Photon Source (Argonne National ... Trang 1Protein rethreading: A novel approach to protein design Sayeh Agah*, Sandra Poulos*, Austin Yu, Iga Kucharska & Salem Faham Protein engineering is an important tool for the ... Protein topology diagrams were prepared with TopDraw31 Data collection and refinement statistics are shown in Table 1 The data was complete to 1.7 Å, but significant data was measured to higher
Ngày tải lên: 04/12/2022, 16:06
A novel approach to automatic detection
... operator uses the nose interest region and analysis horizontal and vertical histograms This operator creates two different horizontal histograms and one vertical histogram The nose holes are darker ... Committee Assoc Prof Dr Hasan Abdullah (BL), Assist Prof Dr Alias Abdulrahman (MAL), Assist Prof Dr Abdullah Aksu, (TR); Prof Dr Hasan Atar (TR), Prof Dr Lale Balas (TR), Prof Dr Levent Bat (TR), Assoc ... facial interest region points can be affected by many components, such as changes of facial emotion, illumination conditions, photographing angle, and distance between object and camera (Huorong
Ngày tải lên: 10/02/2023, 19:53
Báo cáo hóa học: " Research Article A Robust Approach to Segment Desired Object Based on Salient Colors" pot
... true-content-based representation of any video that allows manipulation and adaptation [15] but the challenge is still to develop a system that is able to segment automatically and accurately any videos Indeed, ... 10shows an example of the salient colors retained on the blue sky diver object Colors that are attractive and those that are on the contrary rather dark are automatically selected We used the peak-finding ... the region i, and Ψ(A i) is the number of regions of areaA i.e iis calcu-lated as the sum of the distances to the region color average In this formula, the first term is a normalization factor,
Ngày tải lên: 22/06/2014, 19:20
A new approach to embedded software optimization based on reverse engineering
... Distribution by anyone other than the author(s) is prohibited. Trang 2A New Approach to Embedded Software Optimization Based on Nguyen Ngoc BINH†∗a), Member, Pham Van HUONG†, and Bui Ngoc HAI†, Nonmembers ... Introduction The optimization problem of embedded systems includes hardware optimization, software optimization and co-design - optimizing based on hardware-software partition-ing Hardware optimization ... programs manually that named Example1, rep-etitions of a basic block of random instructions They have a feature that their instructions are less interdependent than the available sample program
Ngày tải lên: 24/10/2016, 11:09
A study on the structural and semantic features of tag questions with reference to vietnamese equivalents based on the bilingual play “ an ideal husband’
... stereotyped tag question, which is a form of constant or unchanging tag question that goes with almost every sentence in the Arabic language ―alaysa kathaleka‖ Based on my observations as an adult ESL ... in addition, intonation has a major role in classifying them as tag questions (Bublitz, 1979) The level of acceptability of an utterance as a tag question also varies among native speakers The ... fantastic car, isn‘t it A British English equivalent of the American exclamatory tag in the above example is isn’t it A fairly recent variation on the tag question as exclamation in American
Ngày tải lên: 17/09/2019, 23:22
Eco tourism model as a sustainable approach to climate change adaptation based on indigenous knowledge of the ethnic minority a case study in ham yen district, tuyen quang province, viet nam
... integrates two distinct approaches to climate change adaptation and mitigation: a top-down scientific approach and a bottom-up regional approach The top-down method focuses on global climate projections, ... the area Minh Huong commune, being a mountainous area, faces numerous challenges that affect the accuracy and professionalism of its statistical data Historical records on population, natural conditions, ... tolerant varieties Notable examples include the cultivation of cardamom, anise, pear, and tangerine in Lang Son, as well as Shan Tuyet tea, orange, and lemon tea in Ha Giang, and Giao co lam and
Ngày tải lên: 25/03/2025, 10:41
Báo cáo khoa học: "A Bayesian Approach to Unsupervised Semantic Role Induction" docx
... improve lexical generaliza-tion (Deschacht and Moens, 2009), and projecgeneraliza-tion of annotation across languages (Pado and Lapata, 2009; van der Plas et al., 2011) Semi-supervised and weakly-supervised ... is assignment of tables to restaurant customers Assume a restaurant with a sequence of tables, and customers who walk into the restaurant one at a time and choose a table to join The first customer ... Trang 1A Bayesian Approach to Unsupervised Semantic Role InductionSaarland University Saarbr¨ucken, Germany {titov|aklement}@mmci.uni-saarland.de Abstract We introduce two Bayesian models
Ngày tải lên: 17/03/2014, 22:20
Báo cáo khoa học: "A Large-Scale Unified Lexical-Semantic Resource Based on LMF" docx
... motivation of Pradhan et al (2007), who present integrated access to corpus annotations as a main goal of their work on standardizing and integrat-ing corpus annotations in the OntoNotes project To ... Registry- and Component-based Metadata Framework In Proceedings of the 7th International Conference on Language Resources and Evaluation (LREC), pages 43–47, Valletta, Malta. Paul Buitelaar, Philipp ... representation, visualization, application. In Proceedings of the Third International Con-ference on Language Resources and Evaluation (LREC), pages 1485–1491, Las Palmas, Canary Is-lands, Spain.
Ngày tải lên: 17/03/2014, 22:20
báo cáo hóa học:" A systematic approach to biomarker discovery; Preamble to "the iSBTc-FDA taskforce on immunotherapy biomarkers"" docx
... Potential collaborations among different laboratories, institutions, companies and international societies which are also focused on similar efforts of standardization and harmonization of goals ... Standardization, Centralization, Validation Although the principles of standardization and validation of assays are the primary purpose of the working group on "Biomarker Validation and Application", ... recommendations for assay parameters, coefficient of variation (CV) and data analysis to report in publications This should also include defin-ing the analytical variation of the assay as well as deter-mining
Ngày tải lên: 18/06/2014, 15:20