... save You can also get Shadow Copy software that will restore accidentally deleted files You can have an automatic robot installed that will remember all those passwords you have and automatically ... a room separate from the family room Apart from a computer, scanner and printer, your work office may need a filing cabinet with a lockable drawer, along with a phone line or two and a fax machine ... to visualize what you will use each area for You haves your workspace which is usually occupied by a computer and chair and you have storage space that is close to the workspace You can use...
Ngày tải lên: 22/10/2013, 19:15
... other parent to admit what a miserable parent he or she is, imagine that they not only know this, but that a court has sentenced them to walk up and down Main Street wearing a sandwich board that ... behavior can be dramatic Lawsuits often take on a life of their own and can be much harder to stop than to start This kind of battle can lead to escalating costs, a dramatically reduced standard ... The American Academy of Child and Adoles cent Psychiatry (AACAP) recommends that parents step back and consider how their divorce may impact their children—and find ways to talk to children that...
Ngày tải lên: 18/04/2014, 14:03
Knock Knock: Seth Godin’s Incomplete Guide to Building a Web Site that Works
... a Web page that does just one thing And that it leads to another page that does just one thing And soon (as soon as possible), your Web pages lead people to the thing you wanted them to all along, ... remarkable or invisible KNOCK KNOCK You can have as many entrances to your site as you want I call these pages “landing pages.” A landing page is the place you link your ads to If you’ve got a ... your ad is really bad, Google will send you a note and fire you Imagine that a media company firing an advertiser for running ineffective ads There’s an art to writing an effective AdWords ad,...
Ngày tải lên: 27/05/2014, 12:52
A.A.? No Way! Alternatives to the status quo programs that fail Charles Delaney pot
... a complete ignorance of SYNERGY That is not a 'new age' idea but an ancient postulate that each of us has to cooperate with God That does not mean we get dragged or carried to our goal: Salvation ... trying to rationalize and validate itself against AA It's AA that should be trying to validate itself against actual science and results! The other things is the books and such are a bit of a rip ... redundant step for a pagan 12) we try to carry this message to alcoholics, and to practice these principles in our daily affairs Another variance and near redundancy since belief, morality, and action...
Ngày tải lên: 27/06/2014, 23:20
Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique
... were diagnosed with facet pain Primary outcome measure was percent change in facet-related pain as measured by Visual Analog Scale (VAS) score at final follow-up visit Secondary outcome was change ... investigate the long-term efficacy of facet debridement for the treatment of chronic back pain originating in the facet joint MATERIALS AND METHODS Patient enrollment and evaluation All patients treated ... 71% of 21 patients at one year follow-up with laser denervation of the dorsal facet capsule Li et al treated patients with RFA of the dorsal rami Three patients had durable response after to 16...
Ngày tải lên: 26/10/2012, 09:32
Một số giải pháp nhằm nâng cao hiệu quả huy động vốn tại NH No&PTNT Thạch Thất
... Ngân hàng Việt Nam nói chung Agribank Việt Nam nói riêng, NHNo&PTNT Thạch Thất bám sát mục tiêu, nhiệm vụ hoạt động đề “nhanh chóng, an toàn, hiệu quả” sở để thực hoạt động kinh doanh Ngân hàng ... nhánh đạo sát NHNo & PTNT Việt Nam NHNo tỉnh Hà Tây nên từ thành lập vào hoạt động, từ đất nước chuyển sang kinh tế thị trường hoạt động hệ thống NHNo & PTNT Việt Nam nói chung NHNo&PTNT Thạch ... Còn lãi suất huy động vốn Agribank cao mức 10,4%/ năm tiền gửi VNĐ 3,9%/ năm tiền gửi USD Vì NH Agribank NH quốc doanh nên tất hoại động kinh doanh NH Agribank nhà nước quản lý chặt chẽ so với...
Ngày tải lên: 16/04/2013, 10:29
How to Create a Compelling Company Story That Inspires Employees to Excel
... annual advertising campaign and not the actual story of the company Smarter companies separate ad campaigns from the portrayal of their image These companies are communicating a more permanent ... company in assorted media events Their product is usually an ad campaign or program to catch public attention There is nothing wrong with that approach except that it is usually just that an annual ... their daily activities Your value statements create a scale of importance within your story Value statements signal to employees what is acceptable and what is not acceptable Values are critical...
Ngày tải lên: 24/10/2013, 09:20
Slide THỰC TRẠNG CHẤT THẢI NHÀ MÁY BIA HUẾ VÀ ẢNH HƯỞNG CỦA NÓ đến NGƯỜI dân THÔN tây THƯỢNG, XÃ PHÚ THƯỢNG, HUYỆN PHÚ VANG, TỈNH THỪA THIÊN HUẾ
... Kg/ngày 580 - Bã hèm - Plastic 80 (Nguồ n: Công ty TNHH Bia Huế ) Theo Nhà máy thì các chấ t thải rắ n cu a nhà máy điều được thu gom và xử lý khá tố t nên khả gây a nh ... ch a thu mua kip ̣ ́ Ông khói thải cao 32m tính từ bề mă ̣t đấ t Khí từ lò Nhà máy Bia Huế Khu vâ ̣n chuyể n sản phẩ m sát nhà dân Người dân số ng sát Nhà máy Bia Huế Đia ... các chấ t thải nhà máy gây a nh hưởng xấ u đế n cuô ̣c số ng cu a ho ̣ đó chấ t thải rắ n và chấ t thải khí chiế m a số Người dân cho rằ ng chấ t thải Nhà máy Bia...
Ngày tải lên: 14/12/2013, 15:40
Tài liệu Universal Credit: welfare that works. pptx
... withdrawal rates and additional tax as earnings increase is called the Marginal Deduction Rate and has the same practical effect as a tax rate Currently, when combined with tax and National Insurance ... the ability to appeal We will also maintain safeguards for vulnerable people and ensure that mental health and substance abuse problems are taken into consideration 16 As now hardship payments ... social and economic cost for individuals, their families and wider society The welfare state has become a vast, sprawling bureaucracy that maintains, rather than really challenges, poverty: a ...
Ngày tải lên: 16/02/2014, 03:20
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc
... QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) Plasmid pET-1TK was used as template and Kleb(HtoA)fw (5¢-GCTTAGCCGCGCCGGCATTCG) and Kleb(HtoA)rv (5¢-CGAATGCCGGCGCGGCTAAGC) ... HAPs are adapted to different habitats To support plant growth, bacteria not need to release phosphate as fast as the diges- tive tract of an animal host, where possible substrates might be available ... of plasmid pET22b(+) (Novagen, Nottingham, UK), containing a C-terminal His6 tag and an N-terminal signal sequence for periplasmic localization [14] The inactive mutant PhyK H2 5A was generated...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc
... LlCBP3 3A, indicating that LlCBP3 3A acts synergistically with LlChi1 8A However, the effect of LlCBP3 3A was small and ceased after approximately 48 h (Fig 6A) This indicates that LlCBP3 3A only acts ... chitin-binding domain of chitinase A1 from Bacillus circulans WL-12 J Bacteriol 182, 30453054 Kojima M, Yoshikawa T, Ueda M, Nonomura T, Matsuda Y, Toyoda H, Miyatake K, Arai M & Fukamizo T (2005) Family ... experimental data and the inferences made from the sequence and structural comparisons above indicate that LlChi1 8A is a nonprocessive endo-acting chitinase, with overall properties that are quite...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Managed Investment Funds Product Disclosure Statement - A range of funds that allows you to create an investment portfolio that suits your individual needs ppt
... Appoint a financial adviser to transact online on my behalf? By appointing a financial adviser to transact on your behalf, you are giving that adviser, and any person acting on behalf of that adviser, ... investors in affected funds of any material change as soon as practicable Taxation considerations are general and based on present taxation laws, rulings and their interpretation as at 12 March 2012 ... that are written in a language that is not English must be accompanied by an English translation prepared by an accredited translator An accredited translator is any person who is currently accredited...
Ngày tải lên: 19/02/2014, 09:20
Báo cáo khoa học: Plant DNA polymerase k, a DNA repair enzyme that functions in plant meristematic and meiotic tissues docx
... S., Kasai, N., Shimazaki, N., Takemura, M., Asahara, H., Linn, S., Yshida, S., Matsukage, A. , Koiwai, O., Sugawara, F., Yoshida, H & Sakaguchi, K (2002) A plant phytotoxin, solanapyrone A, is an ... is 5¢-AGCTACCATGCCT GCACGAAGAGTGCGTATTATGCCTACACTGGA GTACCGGAGCATCGTCGTGACTGGGAAAAC-3¢ [3H]dTTP (10 lM; 10 CiÆmmol)1) and enzymes were added as indicated in the figure legends, and incubated for ... dNTP was analyzed by M urea and 10% PAGE and autoradiography (B) TdT activity was measured under the conditions described in Materials and methods Commercial TdT (Takara) was assayed as a positive...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Molecular characterization of a novel nuclear transglutaminase that is expressed during starfish embryogenesis ppt
... ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG AGAAGAAACAATTACTTCTTAAGTCAATTAATTTTTCTAGAAATGCAAAAGATATTCCCC TTAACAGCTGTTTGAAATGAGGCCTCGGTCTCAAGTTTAAGAGTGCCCCCATATGTAAGC TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG ... A H V T L N V K S A * ATGCGAGGTCAGCATTTATCCAACCAGAAGCTTCACGGAGCTAGCTGGGCAAGGAAATTT GATAATCGCAAGAAATAATTTCCCCCCAAAAACAAAAGGTTGTTGGCTGAAAATACTTCT ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG ... TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG TATTTGGATAAGGTGCATTTGTACATTTTGTGTGTACTGGTTTAGTGTAGAATTTAATTT TTTTTGGTTAATTCTGTCACAAGAACATAATTCTATGGTTACTACACAATGTTGCATCCC AACGCCACCTTTTTATTTTTAATCATATATCATCTCAGTGAAGGTCAGTCCTTG...
Ngày tải lên: 08/03/2014, 10:20
Báo cáo khoa học: The proximity between C-termini of dimeric vacuolar H+-pyrophosphatase determined using atomic force microscopy and a gold nanoparticle technique ppt
... (Invitrogen, Carlsbad, CA, USA), 4390 and the two synthesized oligonucleotides Phis (5Â-CCTCG AGCCATCATCATCATCATCATTAGGGCCGCATCAT GTAATTAGTTATGT-3Â) and PMluI (5Â-GTACACGCG TCTGATCAG-3Â) were inserted ... H+-translocating inorganic pyrophosphatase of plant vacuoles Biochem Biophys Res Commun 168, 11571162 12 Saraan V, Potier M & Poole RJ (1992) Radiationinactivation analysis of vacuolar H+-ATPase and ... L.) Planta 153, 150155 Maeshima M (1991) H+-translocating inorganic pyrophosphatase of plant vacuoles: inhibition by Ca2+, stabilization by Mg2+ and immunological comparison with other inorganic...
Ngày tải lên: 16/03/2014, 02:20
Báo cáo khoa học: Systemic RNAi of the cockroach vitellogenin receptor results in a phenotype similar to that of the Drosophila yolkless mutant ppt
... (AAK15810), S invicta (AAP92450) and P americana (BAC02725), and the vertebrates Anguila japonica (BAB64337), Conger myriaster (BAB64338), Oncorhynchus mykiss (CAD10640), Oreochromis aureus (AA027569), ... was compared with VgRs of the cockroach P americana, the mosquitoes A aegypti, Anopheles gambiae, the fruit fly D melanogaster, and the ant S invicta (Fig 1B) As expected, BgVgR was most similar ... from polyA+ RNA from 3-day-old adult ovaries The primers were as follows: forward 5¢-GAYGGNDTNGAYGAYTGYGG-3¢; and reverse 5¢-ARYTTRGCATCBACCCARTA-3¢ The amplified fragment (980 basepair) was subcloned...
Ngày tải lên: 16/03/2014, 14:20