... significantly different cold-accli-mation capacities, we prove that mathematical model-ling of metabolism and validation by experimental data offers an attractive possibility for the study of complex ... different pots in a random design before and after 1 day, 3 days and 7 days of exposure to 4C Samples were taken after a light period of 8 h At that stage, the aerial part of the plant is exclusively ... [31] Gas exchange was measured in the growth chamber shortly before plant harvesting Means of raw data for gas exchange were converted to flux rates per gram of FW obtained at the end of the exposure...
Ngày tải lên: 14/02/2014, 22:20
... 1992 The ‘liberalization of the EUagricultural market’ indicates the fundamental reform of the CAP ana-in 2003 The energy tax act specifies the energy tax law enacted in 2006 The biofuel quota act ... situations sequentially take place in the actionarena and they are repeated until the stop criteria (final year)are met Agents adapt to the environment in each iteration Theadaptation mechanism ... annually the set-aside land quota depending on the state of the market The extension of the quota oscillated between 5% and 15% of the total agricultural area Farmers were allowed to culti-vate...
Ngày tải lên: 08/11/2022, 14:57
Báo cáo y học: " NF- B subunits RELB C-Rel RELA p50 p52 bound DNA b EMS" docx
... SO performed data analysis PH did statistical analysis INL, DA and SD did auxiliary experimental work and interpretation of data DS supplied material MLB and TS supplied auxiliary data and contributed ... microarrays and EMSA-Seq (Table 3) The canonical AGGAA ATTCCG sequence was bound by the RELA homodimer in all assays Interestingly, all three non-canonical sequences, AGGGGGATCTG, AGGGAAGTTA and ... database This database was accessed and available content downloaded on 15 November 2010 All 3407 TASs in the database were mapped to the nearest BRS and ordered according to distance of the TAS...
Ngày tải lên: 09/08/2014, 23:20
Báo cáo khoa học: Helicobacter pylori single-stranded DNA binding protein – functional characterization and modulation of H. pylori DnaB helicase activity pptx
... Japan) for quantitation Helicase assay The substrate for helicase assay was prepared by annealing a 29 mer oligo (5¢-CCAAAACCCAGTCACGACGTTGT AAAACG-3¢) to M13mp18 single-stranded circular DNA ... 2008 The Authors Journal compilation ª 2008 FEBS A Sharma et al staining was obtained) that are the manifestation of active replication forks in these bacteria (Fig 4A, B, upper panels) HpDnaB and ... has an affinity towards HpDnaB that allows their coprecipitation Association of HpDnaB and HpSSB at high salt concentration indicates that these two proteins may have an affinity towards each other...
Ngày tải lên: 30/03/2014, 02:20
Báo cáo y học: " A balanced transcription between telomerase and the telomeric DNA-binding proteins TRF1, TRF2 and Pot1 in resting, activated, HTLV-1-transformed and Tax-expressing human T lymphocytes" pot
... progression of adult T-cell leukemia Leuk Res 1999, 23:311-316 Kubuki Y, Suzuki M, Sasaki H, Toyama T, Yamashita K, Maeda K, Ido A, Matsuoka H, Okayama A, Nakanishi T, et al.: Telomerase activity and ... 5'CCGCTGCCTTCATTAGAAAG-3', TRF2 sense, 5'-GACCTTCCAGCAGAAGATGC-3' and antisense, 5'-GTTGGAGGATTCCGTAGCTG-3' The thermal cycling conditions consisted of 40 cycles at 95°C for 10 sec, 61°C for sec, 72°C for ... 5'-TGTTTCTGGATTTGCAGGTG-3' and antisense, 5'-GTTCTTGGCTTTCAGGATGG-3', Pot1 sense, 5'TGGGTATTGTACCCCTCCAA-3' and antisense, 5'-GATGAAGCATTCCAACCACGG-3' TRF1 sense,5'-GCTGTTTGTATGGAAAATGGC-3' and antisense: 5'CCGCTGCCTTCATTAGAAAG-3',...
Ngày tải lên: 13/08/2014, 09:21
Tài liệu Báo cáo khoa học: Steady-state and time-resolved fluorescence studies of conformational changes induced by cyclic AMP and DNA binding to cyclic AMP receptor protein from Escherichia coli ppt
... 3Â-TTTTCACACTGTACCTTATTTAATCA-5Â; ICAP (28 bp), 5Â-AATTAATGTGACATATGTCACAT TAATT-3Â and 3Â-TTAATTACACTGTATACAGTGTAAT TAA-5Â The recognition half-sites are shown in bold An equimolar amount of complementary ... sequences of duplexes used in this study were as follows: lac (26 bp), 5Â-ATTAATGTGAGTTAGCTCACTCATT A- 3Â and 3Â-TAATTACACTCAATCGAGTGAGTAAT-5Â; gal (26 bp), 5Â-AAAAGTGTGACATGGAATAAATT AGT-3Â and 3Â-TTTTCACACTGTACCTTATTTAATCA-5Â; ... donor and the acceptor To approximate the distance between the Trp85Cys178 pair, we assumed that the Forster distance ă for the tryptophanIAEDANS pair was 22 A [26,27] The estimated distances are...
Ngày tải lên: 20/02/2014, 23:20
Báo cáo khoa học: Characterization of HbpR binding by site-directed mutagenesis of its DNA-binding site and by deletion of the effector domain pot
... Graphical representation of the relative densities of the free DNA measured at increasing concentrations of HbpR The percentage of free DNA was calculated from densitometric measurements of the ... Tropel and J R van der Meer A B Fig (A) Genetic organization of the hbp genes in Pseudomonas azelaica strain HBP1 Open and grey bars (some as arrows) depict the orientation and the size of the genes; ... radiolabeled bands as the density of the remaining unbound operator fragment at any HbpR concentration divided by that without HbpR (first lane of each panel) The dashed arrow points to the graphical...
Ngày tải lên: 07/03/2014, 17:20
Tài liệu Báo cáo khoa học: The stereochemistry of benzo[a]pyrene-2¢-deoxyguanosine adducts affects DNA methylation by SssI and HhaI DNA methyltransferases pptx
... 5¢-CACCCTTGCGCTCTCTCA 3¢-GTGGGAACGCGAGAGAGT + 5¢-CACCCTTX CGCTCTCTCA 3¢-GTGGGAAC GCGAGAGAGT + 5¢-CACCCTTGCX CTCTCTCA 3¢-GTGGGAACGC GAGAGAGT 5¢-CACCCTTGCGCTCTCTCA 3¢-GTGGGAACGMGAGAGAGT + 5¢-CACCCTTX ... 5¢-TGAGAGAGCGCAAGGGTG 5¢-TGAGAGAGMGCAAGGGTG 5¢-CACCCTTX+CGCTCTCTCA 5¢-CACCCTTGCX+CTCTCTCA 5¢-GAGCCAAY+CGCACTCTGA 5¢-GAGCCAAGCY+CACTCTGA with the effects of the minor-groove (+)-trans-B [a] P-N2-dG adduct ... within the catalytic domain of the M.HhaI with the DNA minor groove play an important role in the methylation reaction The contacts of the M.HhaI small domain with the DNA major groove are responsible...
Ngày tải lên: 19/02/2014, 00:20
Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx
... sequence-specific DNA binding to DNA treatment with cisplatin and the ability of the particular p53 target site to accommodate the cisplatin IACs The higher the probability of formation of the cisplatin IACs ... 474 base pair fragment of the pPGM4 plasmid (not shown), in contrast to the behavior of the analogous pPGM1 fragment [31] These data revealed a clear correlation between the sensitivity of the ... observed for the unmodified targets in the absence of the competitor fragments (first samples of each set) were taken as For other details, see Figs and of the particular p53DBS The frequency of DNA modification...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Roles of the human Rad51 L1 and L2 loops in DNA binding doc
... understanding the reaction mechanism and the regulation of homologous recombination So far, the crystal structures of bacterial RecA, archaeal Rad51 (RadA), yeast Rad51 (ScRad51), human Rad51 (HsRad51), ... RadA (MvRadA), Saccharomyces cerevisiae Rad51 (ScRad51), and Escherichia coli RecA (EcRecA) domains The N-terminal domains, the conserved ATPase domains, and the C-terminal domain are indicated ... Nature 420, 287–293 Kinebuchi T, Kagawa W, Enomoto R, Tanaka K, Miyagawa K, Shibata T, Kurumizaka H & Yokoyama S (2004) Structural basis for octameric ring formation and DNA interaction of the...
Ngày tải lên: 19/02/2014, 06:20
Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc
... 5'CATTTTCTTACCTCCTTAAATTTACCTATAGTATAACCCAATTATTTTTGGTATTCA GTAAAAGAATGGAGGAATTTAAATGGATATCATATTGGGTTAATAAAAACCATAAGT * O1 cl * * –80 O2 O2 –70 –60 –50 –40 –30 O1 O2 * ACAAAAAAATACACGAAAAGCAAACTTTTATGTTGACTCAAGTACACGTATCGTGTAT TGTTTTTTTATGTGCTTTTCGTTTGAAAATACAACTGAGTTCATGTGCATAGCACATA ... DNAs Synthesis of O DNA Synthesis of O1DNA pHC2 GAATTCTTGGTTCTATAGTATCTG PCR11 GACTCAAGTACACGTATCGTGTATA GTAGGTTTA PCR21 AAACCTACTATACACGATACGTGTA CTTGAGTCA IIa ATTCAACAAAAAAATACACGAAAAG CAAACTTTTATGTTGACTCAAGTA ... CAAACTTTTATGTTGACTCAAGTA IIb TACTTGAGTCAACATAAAAGTTTGC TTTTCGTGTATTTTTTTGTTGAAT PCI51 GAATTCTCGCTAATTCTTTTTTATC IIId TTTTTTTGTTGAATACCAAAAATAA TTGGGTTATACTATAG CSP4 CATGCCATGGATGAATAACGGTACAG CSP6...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: DNA-binding characteristics of the regulator SenR in response to phosphorylation by the sensor histidine autokinase SenS from Streptomyces reticuli doc
... CATGAAGCTTGCATGGCCGGGGCC (located upstream of furS) CGAGAATTCGAAAACGAACGGTGC (located upstream of furS and ending at the 5¢-end of binding site I) GTTGAATTCTCGTGTTTATGAGGG (located upstream of ... furS and beginning at the 3¢-end of binding site I) GGAGCTGCAGCCCACGCGATCGCG (located downstream of the start codon of furS) GGTAAGCTTCTCCAGGGTCAGATG (located upstream of hbpS) GCCGAATTCTCCTCAGCATGTCCAG ... Biolabs (Frankfurt am Main, Germany), Roche (Mannheim, Germany), or Promega (Mannheim, Germany) Isolation of DNA and transformations Plasmids were isolated from E coli with the aid of a mini plasmid...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: Akt-dependent phosphorylation negatively regulates the transcriptional activity of dHAND by inhibiting the DNA binding activity pdf
... Gutkind for plasmids, Ms S Okamura, Ms K Shin-Fukuhara, Ms M Yonemitsu, and Dr M Nakagawa for technical assistance, Dr H Saya and Dr T Hirota for advice and discussion on the phosphorylation analysis, ... coexpression of E47 significantly enhanced the activity of dHAND-WT, -Ala-X, or -Ala (Fig 6A and data not shown) It was of interest that coexpression of Akt reduced the transcriptional activity of dHAND-WT/E47 ... The activity of dHAND-Ala-X/E47 was partially reduced by coexpression of Akt But this inhibitory effect of Akt was not detected in the case of dHAND-Ala/E47 (Fig 6A) Luciferase assay was performed...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Transcription termination at the mouse mitochondrial H-strand promoter distal site requires an A/T rich sequence motif and sequence specific DNA binding proteins pptx
... yielded a major termination downstream of AAUAAA signal at the end of CAA*, A being the terminal nucleotide 16 295 of the mouse mt genome (189 nt transcript; Fig 7A and C, lane 4) An additional major ... that of the D-TERM DNA The D-TERM DNA contains the cononical polyadenylation signal sequence AATAAA Further, 20 and 50 molar excesses of Mut1 DNA, with nucleotide replacements targeted to the AATAAA ... double-stranded DNA ) termed D-TERM DNA ) contains the promoterdistal termination sequence of the mouse mt genome immediately upstream of tRNAPhe (16274-5¢-ATTACG CAATAAACATTAACAA-3¢-16295) About...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Pherokine-2 and -3 Two Drosophila molecules related to pheromone/odor-binding proteins induced by viral and bacterial infections ppt
... Kitabayashi, A. N., Arai, T., Kubo, T & Natori, S (1998) Molecular cloning of cDNA for p10, a novel protein that increases in the regenerating legs of Periplaneta americana (American cockroach) ... pattern of phk-2 (A, B) phk-2-GFP transgenic larvae exhibit green fluorescence in the ganglia of the antenno-maxillary organ (A, arrow), in the anterior (A) and posterior (B) spiracles (arrowheads), ... trifluoroacetic acid at a flow rate of 0.4 mLÆmin)1 Fractions were hand-collected according to the absorbance at 225 nm and analyzed by MALDI-TOF mass spectrometry The fraction containing the induced...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: pyr RNA binding to the Bacillus caldolyticus PyrR attenuation protein – characterization and regulation by uridine and guanosine nucleotides potx
... complex has the composition of (PyrR)2-RNA Fig A plot of A2 60 for the free RNA peak, which is obtained by integrating the area under the peak in the s range of 2–2.6 S, against the molar ratio of PyrR ... supplementary Figs S3 and S4) fit adequately to sedimentation of a single tetrameric species with a calculated weight average mass of 78.3 kDa, although an alternative fit of the data to a model for ... by factors of 10 (dotted line) and 100 (dashed line) to make them visible on the same scale as used for the other panels The initial concentration of RNA was 0.3 lM for (A) and four separate aliquots...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: In vitro embryonic developmental phosphorylation of the cellular nucleic acid binding protein by cAMP-dependent protein kinase, and its relevance for biochemical activities pdf
... boxes Amino acids that participate in the coordination of the Zn atom are boxed in dark grey The RGG box is boxed and the putative nuclear localization signal is underlined The arrow shows a putative ... instead, allow translation Cell signals might influence the affinities of La or CNBP for the 5¢ UTR, and the alternative binding of these proteins may lead, either alone or together with additional factors, ... 12 Yasuda J, Mashiyama S, Makino R, Ohyama S, Sekiya T & Hayashi K (1995) Cloning and characterization of rat cellular nucleic acid binding protein (CNBP) cDNA DNA Res 2, 45–49 13 Tomonaga T,...
Ngày tải lên: 16/03/2014, 12:20
Báo cáo khoa học: Recognition of DNA modified by trans-[PtCl2NH3(4hydroxymethylpyridine)] by tumor suppressor protein p53 and character of DNA adducts of this cytotoxic complex potx
... platinum-DNA adduct, was calculated upon the determination of the rb value at which the complete transformation of the supercoiled to relaxed form of the plasmid was attained Samples of pSP73 plasmid ... biochemical or biophysical analysis whereas the samples of CT DNA were exhaustively dialyzed against such a medium An aliquot of these samples was used to determine the value of rb by FAAS or DPP ... confirmed that the replacement of the NH3 group in transplatin by the 4-hydroxymethylpyridine ligand affects the character of DNA adducts of transplatin so that they become capable of reducing the affinity...
Ngày tải lên: 16/03/2014, 14:20