Báo cáo khoa học: Helicobacter pylori single-stranded DNA binding protein – functional characterization and modulation of H. pylori DnaB helicase activity pptx

M13mp18 ssDNA or pUC18 dsDNA alone or a mixture of both was incubated either in the absence or presence of a different amount of HpSSB followed by separation of the DNA–protein complex u

protein – functional characterization and modulation

of H pylori DnaB helicase activity

Atul Sharma1,*, Ram G Nitharwal1,*, Bhupender Singh2, Ashraf Dar1, Santanu Dasgupta2

and Suman K Dhar1

1 Special Centre for Molecular Medicine, Jawaharlal Nehru University, New Delhi, India

2 Department of Cell and Molecular Biology, Uppsala University, Biomedical Center, Sweden

Helicobacter pylori causes gastric ulcer and gastric

adenocarcinoma related diseases in humans [1,2]

Although there are effective therapies against these

bacteria, an increasing incidence of antibiotic

resistance and recurrent infection following treatment

complicates the situation [3,4] Considerable research

has been conducted on the clinical aspects of H pylori

infection but the fundamental aspects of cell cycle and

DNA replication are poorly understood

H pylorican transform from the active helical

bacil-lary form into the dormant coccoid form, which is the

manifestation of a bacterial response towards

anti-biotics, stress, aging and unfavorable conditions [5–8] Almost nothing is known regarding the molecular mechanisms involved in vegetative to coccoid transi-tion and the biology of the dormant coccoid form DNA replication requires the timely interplay of various proteins that co-ordinate initiation, elongation and termination Although H pylori fall into the king-dom of Gram negative bacteria, the sequence analysis

of Helicobacter genome reveals interesting features that include the location of the dnaA gene, approximately

600 kb away from the dnaN-gyrB gene cluster and the absence of important genes such as recF and the

Keywords

DNA replication; helicase; Helicobacter

pylori; replication foci; single-stranded

DNA binding protein

Correspondence

S K Dhar, Special Centre for Molecular

Medicine, JNU, New Delhi 110067, India

Fax: +91 11 26741781

Tel: +91 11 26742572

E-mail: skdhar2002@yahoo.co.in

*These authors contributed equally to this

work

(Received 7 October 2008, revised 10

November 2008, accepted 13 November

2008)

doi:10.1111/j.1742-4658.2008.06799.x

Helicobacter pylori, an important bacterial pathogen, causes gastric ulcer and gastric adenocarcinoma in humans The fundamentals of basic biology such as DNA replication are poorly understood in this pathogen In the present study, we report the cloning and functional characterization of the single-stranded DNA (ssDNA) binding protein from H pylori The N-ter-minal DNA binding domain shows significant homology with E coli single-stranded DNA binding protein (SSB), whereas the C-terminal domain shows less homology The overall DNA-binding activity and tetra-merization properties, however, remain unaffected In in vitro experiments with purified proteins, H pylori (Hp) SSB bound specifically to ssDNA and modulated the enzymatic ATPase and helicase activity of HpDnaB helicase HpSSB and HpDnaB proteins were co-localized in sharp, distinct foci in exponentially growing H pylori cells, whereas both were spread over large areas in its dormant coccoid form, suggesting the absence of active replication forks in the latter These results confirm the multiple roles of SSB during DNA replication and provide evidence for altered replicative metabolism in the spiral and coccoid forms that may be central

to the bacterial physiology and pathogenesis

Abbreviations

dsDNA, double-stranded DNA; Ec, E coli; FITC, fluoroscein isothicyanate; GST, glutathione S-transferase; Hp, Helicobacter pylori; IPTG, isopropyl thio-b- D -galactoside; Pi, inorganic phosphate; SSB, single-stranded DNA binding protein; ssDNA, single-stranded DNA.

helicase loader dnaC [9,10] We have shown recently

that the H pylori (Hp) DnaB helicase can bypass

E coli (Ec) DnaC function in vivo that may explain

the absence of the dnaC gene in H pylori [11,12] The

C-terminal region of HpDnaB is unique, with a 34

amino acid residue insertion region that is essential for

its function [13] Recently, a protein HobA, the

struc-tural homolog of E coli protein DiaA has been shown

to interact with the initiator protein DnaA and this

interaction is essential for DNA replication in

Helicob-acter[14,15]

One protein that is central to the DNA replication,

repair and recombination is single-stranded DNA

binding protein (SSB) [16,17] The N-terminal domain

of SSB is highly conserved and forms an

oligonucleo-tide binding fold, and this region is also responsible

for oligomerization, typically homotetramerization in

eubacteria The C-terminal region is less conserved and

is responsible for protein–protein interaction [18,19]

The proteins that may interact with SSB include DNA

polymerase, RNA polymerase and DNA helicases [20–

22] Although, no direct interaction has been shown

between SSB and DnaB replicative helicase, the

physi-cal interaction between SSB and PriA helicase, the

major DNA replication restart protein, has been

dem-onstrated recently [23] The extreme C-terminal ten

residues are essential for the interaction of EcSSB with

PriA helicase and the deletion of these residues affects

the stimulation of helicase activity of PriA mediated

through SSB [23] Interestingly, deletion of 10 amino

acid residues from the extreme C-terminus affects

in vivo function of EcSSB [24] Taken together, these

results suggest that the extreme C-terminal residues of

SSB are important for protein–protein interaction

To understand the basic DNA replication machinery

of H pylori in detail, we have cloned, over-expressed

and characterized the functional properties of HpSSB

both in vitro and in vivo We found that HpSSB is a

true homolog of SSB in vivo because it can

comple-ment the Ecssb mutant strain and is localized in the

replisome assembly of E coli Furthermore, we show

that HpSSB can modulate the enzymatic activities of

HpDnaB significantly Finally, we report that both

HpSSB and HpDnaB are co-localized in distinct foci

in replicating H pylori but not in the dormant coccoid

form, indicating an important difference between the

two forms regarding bacterial physiology and growth

These results further enhance our knowledge on SSB

proteins from a slow growing pathogenic bacteria and

offer great potential to study DNA–protein and

pro-tein–protein interaction that is central to the DNA

replication machinery in prokaryotes To the best of

our knowledge, this is the first probe into the coccoid

stage demonstrating its distinction from the vegetative, spiral stage in DNA replication activity

Results and Discussion

Cloning, expression, purification and biochemical activity of HpSSB

The coding region of the ORF, HP1245 (annotated as the putative HpSSB homlog) was amplified using spe-cific primers (as shown in the Experimental proce-dures) and genomic DNA from H pylori strain 26695 The amplified PCR product was subsequently cloned

in the expression vector pET28a and was sequenced completely The deduced amino acid sequence was aligned with E coli and Bacillus subtilis SSB sequences using the multiple sequence alignment program clustalw (Fig 1A) Overall, HpSSB shows 30% iden-tity and 45% homology with EcSSB The analysis shows more homology at the N-terminal DNA-binding domain ( 67%) compared to the C-terminal domain ( 34%), which is assumed to be the region responsi-ble for protein–protein interaction Sequence compari-son reveals many interesting features that include the absence of some important residues in HpSSB com-pared to that of EcSSB The tryptophan residues (Trp40 and Trp54 in EcSSB) have been replaced by phenyl alanine residues [25] In vitro, mutations in these residues in EcSSB show a moderate effect on DNA binding His55, a residue important for oligo-merization, is replaced by Ile in HpSSB However, mutation of His55 to Ile does not affect in vitro oligomerization of EcSSB [26]

To purify recombinant HpSSB for biochemical char-acterization, the E coli BL21 codon plus strain was transformed with pET28a-HpSSB construct, as described in the Experimental procedures, and the His-tagged fusion protein was purified using Ni-NTA agarose beads (Fig 1B) The purified His6-HpSSB protein shows an apparent molecular mass of approxi-mately 25 kDa, which is very close to the deduced molecular mass of untagged HpSSB ( 20 kDa) Polyclonal antibodies were raised in mice using the purified His-HpSSB as antigens These antibodies effectively recognized the purified HpSSB antigen (Fig 1C) To prove that HpSSB is truly expressed in

H pylori, a western blot experiment was performed using the same antibodies against H pylori bacterial lysate A single band was detected in the lane contain-ing bacterial lysate confirmcontain-ing the expression of HpSSB in H pylori (Fig 1C) There is a difference in the migration of the recombinant protein and the endogenous protein because the recombinant protein is

Fig 1 Primary sequence analysis of HpSSB and biochemical properties (A) The amino acid sequences of E coli, B subtilis and H pylori were aligned using the CLUSTALW multiple sequence alignment programme *Identical residues; ‘:’ and ‘.’ indicate strongly and weakly similar residues, respectively (B) Coomassie gel showing the expression and purification of His-tagged HpSSB The molecular mass is shown on the right (C) In vivo expression of HpSSB in H pylori The western blot shows the expression of HpSSB in H pylori lysate using polyclonal antibodies raised against HpSSB These antibodies also recognize the recombinant protein efficiently, whereas the pre-immune sera fail to recognize any such band (D) Size exclusion chromatography of HpSSB HpSSB protein, along with the marker proteins, was passed through the Amersham Superdex 200 gel filtration column followed by elution of the proteins The molecular masses of the standard proteins were plotted on a logarithmic scale against the fraction numbers respective to their elution pattern The molecular mass of HpSSB was deduced from the plot (E) HpSSB shows a strong affinity towards ssDNA over dsDNA M13mp18 ssDNA or pUC18 dsDNA alone or a mixture of both was incubated either in the absence or presence of a different amount of HpSSB followed by separation of the DNA–protein complex using agarose gel electrophoresis The retardation pattern of the ssDNA reveals the binding of HpSSB with ssDNA but not with dsDNA (F) Electrophoretic mobility shift assay to show the binding of HpSSB to the short radiolabeled oligonucleotide The intensity of the shifted band increased with an increasing protein concentration before reaching a saturation point.

His-tagged The pre-immune sera under the same

experimental conditions fail to recognize any band,

suggesting the specificity of these antibodies (Fig 1C)

EcSSB forms homotetramers in solution The critical

residue for EcSSB homotetramer formation (His55) is

not conserved in HpSSB [26] To investigate whether

HpSSB forms homotetramers in solution, gel filtration

analysis was performed using different marker proteins

as standards followed by HpSSB A standard curve

was plotted using the log molecular mass values of

various standard proteins against the fraction numbers

of the proteins at which they are eluted (Fig 1D)

From this standard curve, the molecular mass of

HpSSB was calculated to be approximately 80 kDa

These results suggest that HpSSB forms a tetramer in

solution because the molecular mass of monomeric

HpSSB is approximately 20 kDa

Finally, we investigated the DNA-binding property

of HpSSB For this purpose, single-stranded M13mp18

DNA or double-stranded pUC18 DNA, or a mixture

of both, was incubated in the absence or presence of

different quantities of HpSSB followed by resolving

the DNA–protein complexes using agarose gel

electro-phoresis (Fig 1E) The band corresponding to the

M13mp18 ssDNA is retarded significantly with an

increasing amount of HpSSB protein, whereas pUC18

double-stranded DNA (dsDNA) band is not retarded

at all under the same experimental conditions,

indicat-ing that HpSSB shows a strong affinity towards

ssDNA compared to dsDNA Furthermore, the

affin-ity of HpSSB towards ssDNA was documented by

per-forming gel retardation assay using a small oligonucleotide single-stranded radiolabeled probe No shift was observed in the absence of HpSSB, whereas

an increasing amount of HpSSB resulted in a more intense shifted band, finally reaching a saturation point due to the exhaustion of the free probe (Fig 1F) The above results indicate that, although HpSSB shows some differences with EcSSB at the amino acid level, overall, HpSSB shows oligomeric properties and ssDNA binding activities similar to that of EcSSB

Complementation of E coli Dssb strain with HpSSB and in vivo localization of HpSSB

in E coli Although HpSSB showed oligomerisation and ssDNA binding activity in vitro typical of SSB related proteins,

we further analyzed its function as a true SSB homo-log in vivo For this purpose, we performed plasmid bumping experiments where we tried to replace an Ecssb containing plasmid (pRPZ150, ColE1 ori, TcR)

in E coli RDP317 (Dssb::kan) (a kind gift from

U Varshney, IISC, Bangalore, India) with plasmids (AmpR) containing either Ecssb or HpssbWt or HpssbDC20 (deletion of 20 amino acid residues from the C-terminus) or pTRC vector (ColE1 ori, AmpR) alone where the above genes have been cloned [27] The details of the bacterial strains and plasmid con-structs are shown in Table 1 It is important to note that SSB is an essential protein Therefore, if the incoming AmpR plasmids containing test SSB coding

Table 1 Bacterial strains and plasmids.

recA1 endA1 araD139 D(ara, leu)7697 galU galK k- rpsL nupG

Invitrogen

pET28a

HpSSBWt and HpSSB DC 20

pET28 a derivative containing 540 bp and 480 bp of

H pylori SSB full length and C-terminal deletion mutant

This study

E coli RDP317 strain Carries a deletion in its chromosomal ssb gene (ssb::Kan)

and a wild-type copy of the ssb gene on a support plasmid, pRPZ150 (ColE1 ori, TcR)

Gift from U Varshney (IISC, Bangalore, India)

pTRC HpSSBWt and

HpSSB DC 20.

Plasmid expressing HpSSBWt and DC20 ColE1 ori, Amp R This study pET28a HpSSB-mCherry pET28a derivative expressing fusion protein of Wt HpSSB and mCherry This study

(NICED, Kolkata, India)

genes are capable of complementing the Dssb E coli

strain, TcR plasmids will show the TcS, AmpR

pheno-type Using this strategy and Ecssb as a positive

con-trol, we found that continuous subculture of the

bacteria in the media containing Amp and Kan but

lacking Tc helps to replace the TcR plasmid with the

incoming AmpR plasmid with greater than 90%

effi-ciency Similarly HpssbWt shows very high efficiency

( 87%) compared to that of HpssbDC20 or vector

alone control The results are summarized in Table 2

and clearly indicate that Hpssb can complement E coli

Dssb strain in vivo Moreover, the data suggest that the

last twenty amino acid residues are important for

in vivo function of HpSSB because HpssbDC20 cannot

complement the E coli mutant strain It is important

to note that the amino acid residues at the extreme

C-terminal residues of EcSSB have been reported to be

essential because they may be involved in

protein–pro-tein interaction [24] EcSSB, HpSSBWt and

HpSSBDC20 were expressed efficiently in the E coli

mutant strain as shown by SDS⁄ PAGE and Coomassie

staining of the bacterial lysate from the transformed

cells (Fig 2A)

Complementation of E coli Dssb strain using

HpSSB ensures that it can take over EcSSB function

in vivo It has been shown recently using green

fluores-cent protein-SSB that replisome machinery containing

replication proteins assemble at the replication origin

[28] To investigate whether HpSSB can take part in

replisome machinery, we made a His-HpSSB-mCherry

fusion construct where His-tagged HpSSB is fused at

the N-terminus of fluorescent mCherry protein The

protein was expressed and purified from E coli BL21

strain and the purified protein was used for DNA

binding activity mCherry-HpSSB shows DNA-binding

activity that is similar to the Wt HpSSB, suggesting that the fusion of mCherry does not affect the DNA binding property of HpSSB (Fig 2B,C) Subsequently,

we performed in vivo localization experiments using either lag phase or log phase or stationary phase

E coli BL21 cells transformed with mCherry-HpSSB where the expression of mCherry-HpSSB could be induced using isopropyl thio-b-d-galactoside (IPTG) if required The in vivo localization experiments to local-ize fluorescent mCherry proteins indicate that the expression of mCherry-HpSSB is poor in the majority

of the lag phase cells, with somewhat diffused staining pattern (data not shown) Interestingly, the majority of the cells from the logarithmic phase show moderate expression of mCherry-HpSSB with distinct foci (Fig 2D, upper panel) At the stationary phase of growth, these cells show expression of mCherry all over the cell without foci formation (Fig 2D, upper panel) Green fluorescent protein-SSB fusion has recently been used to label replication forks in E coli

in time-lapse microscopy to demonstrate the dynamics

of replication fork movement during a round of repli-cation of the bacterial chromosome [28] We strongly believe that these distinct foci are the replisome foci because the foci are not present in the bacteria from the control stationary phase These results clearly indi-cate that HpSSB can take part in the replisome foci in

E coli, which is consistent with the complementation

of EcSSB mutant strain with HpSSB

Effect of HpSSB on HpDnaB enzymatic activity

We have shown that HpSSB is a true homolog of SSB both in vitro and in vivo SSB interacts with many pro-teins at the replication fork and modulates their activi-ties One of these proteins is DnaB helicase whose activity can be modulated by SSB [22] We have recently cloned, characterized, purified and performed structure–function analysis of the major replicative helicase DnaB from H pylori [13] We were interested

to see whether HpSSB would modulate the enzymatic activities of HpDnaB

One of the hallmarks of the replicative helicases is its DNA-dependent ATPase activity, which is central

to the helicase activity because it provides energy for the DNA unwinding and forward translocation on the replication fork We have recently shown that the ATPase activity of HpDnaB can be stimulated many times in the presence of ssDNA [13] It has been reported that DNA-dependent ATPase activity of DnaB helicase can be inhibited in the presence of SSB protein [22] We also found that the ssDNA-dependent ATPase activity of HpDnaB can be inhibited

signifi-Table 2 Complementation analysis of HpSSB E coli RDP 317

Dssb strain was transformed with various AmpRplasmids (as

indi-cated) and, subsequently, they were grown in continuous

subcul-tures in liquid media in the presence of Amp and Kan Samples

after four subcultures were streaked on agar plates and the

resul-tant single colonies were further patched on agar plates containing

Amp or Amp and Tc The ability of the patches to grow on the

different plates was monitored and the efficiency of plasmid

replacement was counted Amp, ampicillin; Tc, tetracyclin.

Test

SSB

genes

No of

colonies (Amp

resistant)

No of colonies (Amp, Tc resistant)

Efficiency of plasmid replacement Tc(R)

to Tc(S) (%)

cantly in the presence of HpSSB (Fig 3A,B) The

inhi-bition of ssDNA-dependent ATPase activity of HpDnaB

by HpSSB is likely to be due to the inability of DnaB

to bind the SSB-bound DNA EcSSB also shows an

inhibitory effect on DNA dependent ATPase activity

of EcDnaB when ssDNA is taken as substrate [22]

Furthermore, we investigated the effect of HpSSB

on the helicase activity of HpDnaB For this purpose,

the release of a radiolabeled 29 mer ssDNA oligo from

an annealed substrate containing M13mp18 ssDNA

was monitored using HpDnaB and different amount

of HpSSB We found that, initially, HpSSB stimulates the helicase activity of HpDnaB at a lower concentra-tion However, at a higher concentration of HpSSB, the helicase activity was inhibited completely (Fig 3C,D) It is possible that, at a lower concentra-tion of HpSSB, the released ssDNA from the annealed substrate may become stabilized following binding with HpSSB, thereby preventing rehybridization of the unwound oligo with the M13mp18 ssDNA However,

at a higher concentration of HpSSB, the excess multi-meric HpSSB in the vicinity of fork structure may

Fig 2 In vivo function of HpSSB (A) Expression of EcSSB and HpSSB (wild-type and mutant forms) proteins in the E coli SSB mutant strain was checked by SDS ⁄ PAGE analysis of bacterial lysate obtained from un-induced and IPTG induced bacterial culture in each case fol-lowed by Coomassie staining *Position of the respective proteins (B) Purification of His-HpSSB-mCherry protein mCherry was fused with

Wt HpSSB at the C-terminus in pET28a with a His 6 -tag as described in the Experimental procedures The fusion protein was purified using Ni-NTA agarose and the quality of the protein was checked by SDS ⁄ PAGE and Coomassie staining His-HpSSB is also shown (C) DNA bind-ing property of mCherry-HpSSB protein is shown as described earlier for the HpSSB protein The arrowhead indicates the position of the ssDNA in the absence of SSB protein and the subsequent retardation of the band with an increasing amount of SSB is also shown.

*Position of the double-stranded control DNA (D) Localization of mCherry-HpSSB in growing E coli cells E coli strain BL21 was trans-formed with pET28a vector containing mCherry-HpSSB and the bacteria culture was grown in liquid media in the presence of 0.1 m M IPTG.

D 600 was monitored at different time points and glass slides were made to check the fluorescence under the microscope from different growth phases Bright red fluorescent spots were observed from cells obtained from the log phase of the growth (as indicated by arrow-heads) but not from the stationary phase bacteria.

affect the loading of HpDnaB by preventing the access

of HpDnaB to the fork structure

Finally, we were interested in determining whether

HpSSB has any affinity towards HpDnaB We

per-formed co-precipitation experiments in the presence of

ammonium sulfate as described previously [29] We

found that HpSSB is precipitated completely in the

presence of ammonium sulfate because most of it can

be seen in the pellet fraction following precipitation

and SDS⁄ PAGE analysis Interestingly, most of the

HpDnaB can be found in the supernatant fraction

following precipitation in the presence of ammonium

sulfate under the same experimental conditions

(Fig 3E) However, when we performed co-precipita-tion experiments using both HpDnaB and HpSSB under the same experimental conditions, most of the HpDnaB was found in the pellet fraction along with HpSSB (Fig 3E) These results suggest that HpSSB has an affinity towards HpDnaB that allows their coprecipitation

Association of HpDnaB and HpSSB at high salt concentration indicates that these two proteins may have an affinity towards each other To substantiate this issue further under more physiological conditions,

we performed a pull-down assay using beads of gluta-thione S-transferase (GST)-HpDanB beads or GST

A

C D

B

E F

Fig 3 (A) Effect of HpSSB on ATPase activity of HpDnaB in the presence of ssDNA The release of radiolabeled P i from (c- 32 P)ATP was monitored in the absence and presence of different concentrations of HpSSB in a mixture containing HpDnaB and ssDNA by thin-layer chro-matography The positions of ATP and released Pi are shown (B) The amount of released Piin each case was quantified using densitometric scanning and the values were plotted accordingly (C) The effect of HpSSB on helicase activity of HpDnaB The release of unwound oligo from radiolabeled substrate by HpDnaB was monitored in the absence and presence of different concentrations of HpSSB (D) The amount

of released oligo in each case was quantified using densitometric scanning and the values were plotted accordingly (E) Co-precipitation of HpSSB and HpDnaB The retention of HpSSB or HpDnaB alone or a mixture containing both the proteins in the pellet (P) and supernatant (S) fraction was monitored following ammonium sulfate precipitation and subsequent SDS ⁄ PAGE analysis The positions of both the proteins are indicated (F) GST pull-down experiments either using GST-HpDnaB or GST proteins in the presence of purified HpSSB proteins at a low salt concentration (50 m M NaCl) followed by washing the beads and SDS ⁄ PAGE and western blot analysis of the released proteins using anti-SSB sera HpSSB binds specifically to HpDnaB but not to GST alone under the same experimental conditions.

alone in the presence of HpSSB protein The

pull-down experiments were carried out at a low salt

concentration (50 mm NaCl) followed by washing the

beads first using the binding buffer and, finally, at high

stringency (300–500 mm salt concentration) The

pull-down experiments indicate that HpSSB interact

specifi-cally with GST-HpDnaB but not with control GST

protein under the same experimental conditions

(Fig 3F) Thus, association of HpDnaB and HpSSB

both at the low and high salt concentrations suggests

that these proteins may physically interact with each

other A similar interaction has been reported between

replication restart helicase PriA and SSB protein in

E coli[23]

The interaction of SSB with DnaB helicase appears

to be biologically relevant because the loading of the

HpDnaB helicase may be facilitated by SSB bound to

single-stranded moiety at the fork structure In

chro-mosomal DNA replication, initiation of Okazaki

frag-ments requires SSB coating of the lagging strand;

similar coating plays a critical function in the restart

of paused replication forks where SSB–DnaB

interac-tions might play critical, although yet undefined roles

[22] Unlike EcDnaB, HpDnaB does not require a

heli-case loader (EcDnaC) [12] Hence, HpSSB might have

a closer and more specific interaction with the HpSSB

C-terminal that shows poor homology compared to that of the EcSSB C-terminal region

Comparison of localization of replication proteins between the active helical bacillary form and the dormant coccoid form of H pylori

As discussed earlier, H pylori undergoes morphologi-cal transition from the spiral shape to the coccoid form under physiologically unfavorable conditions It

is reported that the coccoid form is the degenerate form of the bacteria leading to cell death [30] There are also reports indicating the presence of bacterial enzymatic activities in the dormant form, suggesting the continuation of metabolic activity at this stage [31– 33] We compared the DNA replication machinery in

H pylori in the helical bacillary form and in the coc-coid stage by attempting to detect and localize active replication forks For this purpose, we used two inde-pendent markers of active growing replication forks (HpSSB and HpDnaB, respectively) and followed their localization pattern in the above two forms by immu-nofluorescence microscopy using specific antibodies against these markers We obtained striking results, where the majority of the active bacillary forms show clear distinct foci of HpDnaB and HpSSB (wherever

A

C

B

Fig 4 Immunolocalization of HpDnaB and SSB proteins in H pylori bacillary and coccoid forms (A) Glass slides containing either the bacil-lary form (upper panel) or coccoid form (lower panel) were treated for immunofluorescence (as described in the Experimental procedures) using HpSSB antibodies (mice, 1 : 500 dilution) followed by FITC conjugated anti-mice sera as secondary antibodies Green fluorescence was detected using a fluorescence microscope (B) Localization of HpDnaB in the above two stages of H pylori HpDnaB antibodies (rabbit,

1 : 500) were used as primary antibodies and Alexafluor594 conjugated anti-rabbit sera were used as secondary antibodies (C) Co-localiza-tion of HpDnaB and HpSSB proteins in the bacillary form Both the HpDnaB and HpSSB antibodies were used in combinaCo-localiza-tion as primary antibodies Alexafluor594 conjugated anti-rabbit and FITC conjugated anti-mice secondary sera were used in combination.

staining was obtained) that are the manifestation of

active replication forks in these bacteria (Fig 4A,B,

upper panels) HpDnaB and HpSSB foci also

co-local-ized completely with each other, confirming the

pres-ence of active replication forks in the bacillary form

(Fig 4C) These results also suggest that these proteins

are the components of the replisome complex in vivo

and validate our in vitro co-precipitation and

pull-down results (Fig 3E,F) Interestingly, the coccoid

forms showed diffused staining pattern for both the

proteins (Fig 4A,B, lower panels) The absence of

dis-tinct replication foci in the coccoid forms clearly

sug-gests that these forms are physiologically different

from the bacillary form It has been reported

previ-ously that the DNA content of the coccoid forms is

very low compared to the bacillary forms [30] Taken

together, these results suggest that either very low or

no DNA replication takes place in the coccoid forms

In summary, we have reported the functional

char-acterization of the SSB protein from an important

pathogen H pylori Although it shows divergence from

the EcSSB at the key residues involved in DNA

bind-ing and oligomerization for EcSSB, surprisbind-ingly, it can

complement an Ecssb mutant strain and is localized at

the replisome containing growing replication fork in

E coli and also in H pylori Moreover, both

DNA-dependent ATPase and helicase activity of HpDnaB

can be modulated by HpSSB Whether the modulation

effect is due to the titration of ssDNA in the presence

of HpSSB, or due to the possible interaction between

the two proteins, remains to be elucidated However,

co-precipitation of HpSSB and HpDnaB, in vitro

pull-down experiments and in vivo co-localization of these

proteins in the bacillary form raise the possibility that

these two proteins may have an affinity with each

other Finally, the absence of distinct replication foci

in the coccoid form clearly indicates a physiological

difference from the active bacillary form

Experimental procedures

Bacterial strains

The bacterial strains and plasmids used in the present study

are listed in Table 1 E coli strains were grown in LB

media (supplemented with 100 mgÆmL)1 ampicillin or

50 mgÆmL)1 kanamycin wherever needed) either at 37 or

22C, as required

H pylori culture

H pylori strain 26695 was grown on brain heart infusion

agar (Difco, Sparks, MD, USA) supplemented with 7%

horse blood serum, 0.4% IsoVitaleX and the antibiotics amphotericin B (8 mgÆmL)1), trimethoprim (5 mgÆmL)1) and vancomycin (6 mgÆmL)1) The plates were incubated at

37C under microaerobic conditions (5% O2, 10% CO2) for 36 h

The coccoid form of H pylori cells was obtained from the culture plates kept for prolonged periods of 10–14 days,

as described previously [34,35], at 37C under the same conditions The morphology of bacteria was observed under the microscope and cells from both the bacillary and coccoid form cultures were harvested and used for the immunofluorescence assay

DNA preparation methods

E coli plasmids DNA were prepared by the alkaline lysis method [36] Bacteriophage M13mp18 single-stranded circular DNA was prepared as per the protocol described previously [37] H pylori genomic DNA was isolated from confluent culture grown on BHI agar using the cetyl trimethyl ammonium bromide-phenol method [38]

DNA manipulation

In the H pylori genomic database, an ORF (HP1245) was annotated as the putative HpSSB homolog The 540 bp long DNA fragment representing the ORF was amplified

by PCR using H pylori strain 26695 genomic DNA as tem-plate with forward and reverse primers having BamHI restriction sites using Pfu DNA polymerase Similarly, a fragment with a deletion of 60 bp representing the last 20 amino acids at the C-terminus of the Hpssb gene was amplified by PCR

The PCR-amplified HpssbWt (540 bp) and HpssbDC20 (480 bp) DNA fragments were cloned in the expression vector pET28a (Novagen, Madison, WI, USA) at the

complementation assay, wild-type and HpssbDC20 genes were subcloned from the respective pET28a recombinant clones into pTRC vector at the NcoI–HindIII restriction sites For pET28a-HpSSB-mCherry constructs, the Hpssb gene was amplified using the same forward primer, but a reverse primer without a stop codon and with a SacI site, and cloned into pET28a at the BamHI–SacI site followed

by cloning of PCR amplified mCherry gene fromP RSET-B-mCherry [39] at the SacI–XhoI site [HpSSB full length for-ward BamHI, 5¢-CG GGATCCATGTTTAATAAAGTGA TTATGG-3¢; HpSSB full length reverse BamHI,5¢CG GG ATCCCTTCATCAATATTGATTTCAGG-3¢; HpSSBDC20 reverse BamHI, 5¢-CGGGATCCTCACTGTGCTTGTAA ATTCTC-3¢; SSB reverse SacI (without stop codon), 5¢-CG AGCTC AAA GGG GAT TTC TTC TTC-3¢; mCherry forward SacI, 5¢-CGAGCTC ATG GTG AGC AAG GGC GAG-3¢; mCherry reverse XhoI, 5¢-CCGCTCGAG TTA CTT GTA CAG CTC GTC C-3¢]

Purification of His-tagged Wt and DC20 HpSSB

protein

E coli strain BL21 (DE3) (Novagen) harboring pET28a

HpSSB (Wt), DC20 SSB and SSB-mCherry constructs was

grown at 37C in LB media containing 50 mgÆmL)1

kana-mycin The bacterial cultures were induced for the

expres-sion of the recombinant proteins using 0.25 mm IPTG at

22C for 4 h His-tagged proteins were purified using

Ni-NTA agarose beads (Qiagen, Hilden, Germany) in

accordance with the manufacturer’s instructions The eluted

proteins were dialyzed against dialysis buffer containing

50 mm Tris–Cl (pH 7.5), 1 mm EDTA, 100 mm NaCl,

100 mm phenylmethanesulfonyl fluoride and 10% glycerol

DC20SSB were dialysed against MonoQ and MonoS

buf-fers and subjected to ion exchange chromatography using

MonoQ and MonoS ion-exchange columns (GE

Health-care, Uppsala, Sweden) in accordance with the

manu-facturer’s instructions The fractions of ion exchange

chromatography were then checked on 10% SDS⁄ PAGE

and pooled and dialysed against dialysis buffer

Protein concentrations were determined by the

Brad-ford method (Bio-Rad, Hercules, CA, USA) in

accor-dance with the manufacturer’s instructions with BSA as

standard Western blot analysis was carried out following

standard procedures to check the proteins

Agarose gel retardation assay

ssDNA binding activity of Wt HpSSB, DC20 and

HpSSB-mCherry was checked by incubating the Wt and DC20

SSB protein in varying concentrations (0, 0.45, 0.9, 1.8,

2.7 and 3.6 lg, respectively) with 300 ng of M13mp18

single-stranded circular DNA and⁄ or 300 ng of pUC18

double-stranded circular DNA in binding buffer (20 mm

dithiothreitol, 4% sucrose and 80 lgÆmL)1 BSA) in a

20 lL reaction mixture After 30 min of incubation on ice,

reaction mixtures were resolved in 0.7% agarose gel along

with M13mp18 ssDNA alone, as a control The

ing retardation of the nucleoprotein complex with

increas-ing concentrations of SSB indicates the ssDNA bindincreas-ing

activity of test proteins BSA was taken as a negative

control

Electrophoretic mobility shift assay

Thirty-two nucleotide ssDNA oligo (CGGGA CCATGCG

CCAAAAAATGCCTAAAGAC) from Microsynth (Balgach,

Switzerland) was radiolabeled using (32P)ATP(cP) with the

help of polynucleotide kinase enzyme and the purified

labeled oligos were incubated in the absence or presence of

HpSSB (20, 60, 100, 140 and 180 ng) in binding buffer

(20 mm Tris–HCl, pH 8.0, 1 mm MgCl2, 100 mm KCl,

8 mm dithiothreitol, 4% sucrose, 80 lgÆmL)1 BSA) for

30 min at room temperature (25C) and separated on a 6% native PAGE The native gel was run at 150 V for 2 h

in 1· TBE buffer (Tris 89 mm, pH 8, boric acid 89 mm, EDTA 2 mm) The complex and the free DNA were visual-ized by autoradiography

Oligomerization status

Wt HpSSB (500 lg) was subjected to size-exclusion chromatography on a Pharmacia Superdex 200 gel filtration column (Amersham Biosciences, Uppsala, Sweden) in a buffer containing 50 mm Tris–HCl (pH 7.4), 1 mm EDTA,

100 mm phenylmethanesulfonyl fluoride, 10% glycerol,

10 mm b-mercaptoethanol and 100 mm NaCl The column was previously calibrated using Pharmacia low- and high-molecular weight standards as indicated Fractions (0.3 mL) were collected and checked for the presence of proteins by SDS⁄ PAGE

ATP hydrolysis assay

The ATPase activity of HpDnaB with and without SSB was measured in a reaction mixture (20 lL) containing

20 mm Tris–HCl (pH 8.0), 1 mm MgCl2, 100 mm KCl,

8 mm dithiothreitol, 4% sucrose, 80 lgÆmL)1 BSA, 1 mm ATP, 3.4 fmol of (c-32P)ATP and the required amount of DnaB (50 ng), along with 1 pmol of M13mp18 ssDNA and various concentrations of SSB The reaction mixtures were incubated at 37C for 30 min and the reactions were stopped by putting the tubes on ice Released inorganic phosphate (Pi) was separated by thin-layer chromatography

on a poly ethylenemine cellulose strip (Sigma-Aldrich,

St Louis, MO, USA) in 0.5 m LiCl and 1 m formic acid at room temperature for 1 h The thin-layer chromatography plate was dried, autoradiographed and analyzed by a phos-phorimager (Fujilm-BAS-1800; Fuji, Tokyo, Japan) for quantitation

Helicase assay

The substrate for helicase assay was prepared by annealing

a 29 mer oligo (5¢-CCAAAACCCAGTCACGACGTTGT AAAACG-3¢) to M13mp18 single-stranded circular DNA This annealed substrate has a six bases long 5¢ tail Helicase assay was carried out in a 20 lL reaction mixture contain-ing 20 mm Tris–Cl (pH 8.0), 8 mm dithiothreitol, 2.5 mm MgCl2, 2 mm ATP, 80 lgÆmL)1 BSA, 10 mm KCl, 4% sucrose and 10 fmol of helicase substrate and the indicated amount of HpDnaB and HpSSB HpDnaB protein (3.0 ng) was incubated in above buffer for 15 min (on ice) and then the indicated amount of HpSSB was added to the reaction This mixture was incubated at 37C in a water bath for