... remedies), and considerations of the actual teaching and learning contexts Keywords: Assessment, Assessment for Learning (AFL), Formative Assessment (FA), Teacher Assessment Practice (TAP), Teaching ... curriculum and instruction for English language learners…’ Abedi [18] also indicated a problematic issue facing teacher assessment practice: ‘the teacher-made FAs may not cover state content standards ... skills; and (3) lessons follow exercise format reviewing what has been taught/learnt As revealed by the three teachers, most of the available time was used for pronunciation, vocabulary and grammar
Ngày tải lên: 14/12/2017, 20:33
... extraction For mutational analysis of codons 12 and 13 of the KRAS gene a 179 bp frag-ment was amplified by polymerase chain reaction (PCR) TGAATA-3′ (sense) and 5′- CTGTATCAAAGAATGG TCCT GCAC-3′ (antisense).15 ... desmoplastic stroma were estimated visually to guaran-tee a valid tumor cell content Genomic DNA was then extracted from formalin-fixed and paraffin-embedded tissue with the QIAamp DNA mini kit (Qiagen, ... Original magnification a-d: 400x Trang 4analysis of IGF1R- and IR-expression was based onthe same TMA cores Assessment of DNA mismatch repair protein immunostaining The expression of DNA mismatch
Ngày tải lên: 06/08/2020, 05:50
ENGINEERING PROJECT MANAGEMENT the IPQMS method and case histor a case for infracstructure renewal with accountability
... Trang 11 A Case for Infrastructure Renewal with Accountability 1.1 INTRODUCTION 7KHPDLQSXUSRVHRIWKLVERRNLVWRLQWURGXFHWKH,3406,QWHJUDWHG3ODQ ... SRVWPRUWHPVRIWKHRSHUDWLRQRIWKH7UDQV$ODVND3LSHOLQH6\VWHP&KDSWHU WKH(3$6XSHUIXQG3URJUDPVWR&KDSWHUDQGWKH+DQIRUG1XFOHDU 5HVHUYDWLRQ&KDSWHU 1.4 NUCLEAR WASTE CONTAMINATION 7KHDJHRI QXFOHDUHQHUJ\ ... QLWLHV VXFK DV /RYH &DQDO 1HZ <RUN ² &RQJUHVV LQ HQDFWHG WKH &RPSUHKHQVLYH(QYLURQPHQWDO5HVSRQVH&RPSHQVDWLRQDQG/LDELOLW\$FW &(5&/$ZKLFKTXLFNO\EHFDPHNQRZQDV6XSHUIXQG7KHODZSURYLGHG
Ngày tải lên: 17/09/2020, 16:13
NECESSITY FOR THE DEVELOPMENT OF MEDIUM-SIZED ENTERPRISES IN HOCHIMINH CITY: A CASE STUDY OF THE ELECTRONIC AND INFORMATION TECHNOLOGY AND MECHANICAL SECTORS
... Park, 2008; Hidayet, Canan, Onur, & Hakan, 2010; Ayyagari, Demirguc, & Maksimovic, 2011; Jasra, Ahmed, Aziz, Rauf, & Muhammad, 2011; Shinozaki, 2012; and Sibel, 2015) Trang 867 development ... Vietnam was studied by Pham and Shino (2015); and Catherine, Nguyen, Nguyen, and Tran (2017) Both studies showed that there was a lack of medium-sized enterprises in Vietnam for many years Pham and ... enterprises have been in operation for three years or more (of which, 68% have been operating for more than 10 years) A total of 43 online questionnaires were 3 Survey data and methodology are available
Ngày tải lên: 03/04/2021, 18:19
A case for english language activation for intermediate and more advanced students
... to the conversation and take notes on Samia’s questions You will then be asked to take her place and answer Andrew’s questions and comments, My name is Andrew Brown, and I’ve just saved three puffins, ... doctor and asks for an appointment 3 Specialist: Dr Chapman speaking What can I do for you? Specialist: No Take the part of John Boot now and ask for the appointment Use your notes x Hubert Forbes ... Tam ata loss What on earth am I going todo ? and to express surprise: The strange thing is that What's strange is that What I don’t understand What gets meis that and to ask someone a
Ngày tải lên: 28/06/2022, 16:16
Effects of human resource training practices on employees performance in tanzania a case of dar salaam water and sewerage authority
... Performance in Tanzania: A Case of Dar Salaam Water and Sewerage Authority Miraji Changale1,*, David Mosoma2 1St Augustine University of Tanzania, School of Postgraduate Studies, Dar es Salaam ... satisfaction and organizational performance is stronger than the connection between organizational performance and job satisfaction 2.1 Conceptual Framework Human Resource training practices are ... nature of the data collected in a mixed methods approach requires a combination of qualitative and quantitative data analysis tools Content data analysis for verbal or written responses used for
Ngày tải lên: 11/10/2022, 16:23
Waiver Work Product and Worry- A Case for Clarifying the Waiver
... greater detail Finally, Part VIII analyzes Oklahoma’s work-product case law and statutes and provides a suggested approach to waiver Specifically, this Comment suggests that Oklahoma adopt a waiver ... obtain the information.”83 In an Ecuadorian proceeding by Ecuadorian plaintiffs against Chevron for alleged pollution of the Amazon, an Ecuadorian court ordered that a neutral expert draft a report ... information against opposing parties, rather than against all others outside a particular confidential relationship, in order to encourage effective trial preparation”—before holding that “[a]
Ngày tải lên: 23/10/2022, 13:01
Buttressing the middle: a case for reskilling and upskilling americas middle skill workers in the 21st century
... our adult population fail to demonstrate levels of literacy and numeracy that are associated with important social and labor market outcomes Further analyses of these data reveal that adequate ... upskilling and reskilling are better able to adapt and thrive in a rapidly changing world—one where education and skills are likely to play an increasingly important role Irwin Kirsch and Anita Sands ... lessons" that allow for rapid absorption and rehearsal and that practice items are followed by immediate feedback Ultimately, the instructional content should be relevant, allow for learner and instructor
Ngày tải lên: 23/11/2022, 18:55
introduction to logistics and supply chain management cold storage warehouse simulation a case for fruit products
... process as the outputs denoted by Y, and we also get the sample standard deviation Table 2 8: The mean value and the sample standard deviation in simulation Sample standard deviation in simulation ... the capacity of the resource warehouse staff 1, warehouse staff 2, and warehouse staff 3 Trial 3: 2 staffs for each of positions, namely warehouse staff 1, warehouse staff 2 and warehouse staff ... Ministry of Agriculture and Rural Development) traditional markets (such as formal and temporary markets) of which 47-52% goes to fruit and about 58-67% goes to vegetables at formal markets These
Ngày tải lên: 22/07/2024, 17:29
Research "MANAGING SIMULATION BASED TRAINING A FRAMEWORK FOR OPTIMIZING LEARNING, COST, AND TIME " pot
... standard formulae for the standard deviation for stationary means cannot be applied Fortunately, the rate of loss for most aircraft approaches an asymptotic limit As a result, the mean at any ... Effectiveness Ratio and Total Training Resources 4 Chapter III: Optimization Framework and Computational Form 5 Chapter IVA: F/A-18 Training Program and Formulation 6 Chapter [VB and Chapter [VC: Formulation ... for the forecast years The chart at right depicts the ten year death rates and flight hours for the A-10 The shaded box indicates forecast values Forecast Cumulative Average Fatality
Ngày tải lên: 23/03/2014, 05:23
ASTM A 53_SPECIFICATION FOR PIPE, STEEL, BLACK AND HOT-DIPPED, ZINC-COATED, WELDED AND SEAMLESS SA-53/SA-53M ppt
... pressure applications and is also acceptable for ordinary uses in steam, water, gas, and air lines. It is suitable for welding, and suitable for forming operations involving coiling, bending, and flanging, ... by Information Handling Services SA-53/SA-53M 2001 SECTION II TABLE X3.2 BASIC THREADING DATA FOR STANDARD-WEIGHT PIPE IN NPS 8 (DN 200) AND LARGER, AND ALL SIZES OF EXTRA-STRONG AND ... thread in accordance with the gaging practice and tolerances of ANSI B1.20.1. For standard-weight pipe NPS 6 [DN 150] and smaller, refer to Table X3.1 for threading data. For standard- weight pipe
Ngày tải lên: 10/07/2014, 23:20
Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc
... transcriptase (Phar-macia) For reverse transcription PCR, human Cyp7b sense (GTCCTGGAGAAATATTATGTGCAG) and antisense (CGCACACAGTAGTCCCCGG) primers were used For GAPDH we used CCCTTCATTGACCTCAACTACATGG ... L, Karin M: Mammalian MAP kinase signalling cascades. Nature 2001, 410:37-40. 14 Palanki MS: Inhibitors of AP-1 and NF-kappa B mediated tran-scriptional activation: therapeutic potential in autoimmune ... Cohn L, Ray P, Ray A: A critical role for NF-kappa B in GATA3 expression and TH2 differentiation in allergic airway inflammation Nat Immunol 2001, 2:45-50. 17 Hammaker DR, Boyle DL, Chabaud-Riou
Ngày tải lên: 09/08/2014, 07:20
báo cáo khoa học:" A ‘short walk’ is longer before radiotherapy than afterwards: a qualitative study questioning the baseline and follow-up design" potx
... simulator to plan Table 1 Cognitive process models of Tourangeau et al. and Rapkin & Schwartz Tourangeau et al. - survey answering model - Rapkin & Schwartz - QoL appraisal model - Example ... always have weary legs. And that happens when I have worked long and hard, after physical strain. And that isn ’t the case now, thus no, I do not feel tired at all.” Follow-up a nswer: quite a bit; ... pain . Since my current pain isn’t as bad as toothache, I opt for ‘quite a bit’.” [Male, 78 years, prostatic cancer] The questionnaire format allows patients to assess their overall health and
Ngày tải lên: 12/08/2014, 01:21
Báo cáo khoa học: "Individually Coded Telemetry: a Tool for Studying Heart Rate and Behaviour in Reindeer Calves" ppt
... responses and may adversely affect the animals’ welfare Due to the rapid development in management practices it has become impor-tant to study the behavioural and physiological changes associated ... captive reindeer calves Materials and methods Animals and experimental design The study was carried out during March 1997 the ration in the morning and the rest at noon Fresh water was available ... has been calculated as an average of individual mean values The box-plot presentation shows the standard median, and 10, 25, 75 and 90 percentiles The square plot presents the average and the outermost
Ngày tải lên: 12/08/2014, 15:20
microsoft access a primer for relational database design and use
... systems? Cheap, readily available (packaged with MS-Office Premium) Easy to use (relative to other systems –Oracle may require one FTE to maintain the server as a database administrator and another ... unstable with greater than 3-5 Trang 7What is in an MS-Access file - 1?Although the term “database” typically refers to a collection of related data tables, an Access database includes more than ... indicates there are 203 Females and 261 Males in the database Trang 29Query – Grouping Data -2Totals Options Include: Group BySum AvgMinMaxCountStDev Trang 30Query – Export DataCreate and Save
Ngày tải lên: 24/10/2014, 15:10
The food chemistry laboratory - a manual for experimental foods, dietetics, and food scientists
... Interdisciplinary Food Safety Research Neal M Hooker and Elsa A Murano Automation for Food Engineering: Food Quality Quantization and Process Control Yanbo Huang, A Dale Whittaker, and Ronald E Lacey Trang ... publications in text with author name and year Use “and others” rather than “et al.” In parentheticalcitations, do not separate author and year with a comma Use commas to separate publications ... variables are placed on the x-axis (abscissa) and dependent variables areplaced on the y-axis (ordinate) Generally, use a line graph when the independent variable is continuous, and a bar graph
Ngày tải lên: 21/04/2015, 13:38
Internationnal payment A case study of freight forwarding and logistics companies in Vietnam Luận văn thạc sĩ
... survey and literature research I hope it can be applied to a practical situation I would like to assure that the research of “International Payment: A case study of freight forwarding and logistics ... forwarding and logistics companies in international payment 35 4.4 Undertaking CAD via forwarding and logistics companies 36 4.4.1 Procedure for settling CAD via freight forwarders ... 408 Fax ( 662 ) 6514667 -8 Email : mayuree@transaircargo.com From: saowaros [mailto:saowaros@transaircargo.com] Sent: Wednesday, June 17, 2009 11:24 AM 92 To: 'Thu Pax/SGN'; mayuree@transaircargo.com
Ngày tải lên: 26/05/2015, 08:33
A calculus for stochastic qos analysis and its application to conformance study
... thisthesis and is applied to analyze various end-to-end stochastic QoS performance In Trang 241.2 Stochastic QoS 9addition, it is shown that a server serving an aggregate of flows can be regarded as a ... -server to chcharac-archarac-acterize service fluctucharac-ation provided to in-put flows Recently, there is an effort towards a statistical network calculus byBurchard, Liebeherr and Patek in [35][36] ... factors and to what extent these factorscan cause conformance deterioration are still not clear without analytical analy-sis In addition, the work in [41] only considered the impact of interactions
Ngày tải lên: 11/09/2015, 21:20
A quest for identity returnee filmmakers and postwar shanghai cinema, 1945 1949
... many help form Central Library of National University of Singapore, Shanghai Library and Peking University Library I want to thank my graduate classmates Fan Xue, Fan Rui, Ji Xing, Wang Yue and ... and melodrama ambiguously The study of returenee filmmakers provides an opportunity to break through the boundaries of geography (the Great Rear Area/Shanghai) and producers (filmmakers/drama ... Junxiang, 1947), and Ideal Son-in-law (Zhang Junxiang, 1947) They experienced trauma even death during war-time and even more problems after they went back to Shanghai when civil war started
Ngày tải lên: 26/09/2015, 09:47
myers et al - 2003 - exploring the term of the auditor-client relationship and the quality of earnings a case for mandatory auditor rotation
... issuance of qualified audit opinions (Bartov et al 2000), audit failures (Geiger and Raghunandan 2002), and auditor changes (DeFond and Subramanyam 1998), while lower accruals levels are associated ... numerous accounting studies that consider the relation between earnings management and accruals behavior, and earnings quality and accruals behavior Early studies used the change in Total Accruals as ... B, and on the raw values in Panel C for our two accruals measures Panel A reveals that the coefficients for Tenure are negative and significant for both Discretionary and Current Accruals That...
Ngày tải lên: 06/01/2015, 19:43