... costs and the statistical methods used to perform the analysis Any defence against an accusation of having manipulated the LIBOR fixing will therefore depend heavily on being able to analyse the ... 17 March 2011 For each maturity, the BBA ranks the 16 rates from highest to lowest and then drops the highest and the lowest The remaining rates are averaged, and this average is reported as the ... distorted, and second that the model of bank costs is an accurate reflection of those costs One cannot tell whether rejection of the hypothesis is because the data are saying that LIBOR was in fact manipulated,...
Ngày tải lên: 22/03/2014, 17:20
... ecliptic plane, also called the zodiacal plane (because the constellations of the zodiac are arrayed around this plane) And that’s why the planets and the Sun and the Moon apparently move through the ... goes around in another way All of the planets go around in the same sense And, as far as he knew then, they all rotated in the same sense The planets had something astonishingly regular about them ... natural world without the interposition of any capital-W Watchmaker That was natural selection The ideas behind natural selection were that there was such a thing as a hereditary material, that...
Ngày tải lên: 06/07/2014, 01:46
A Brief Tour of the X Display Environment
... on a laptop and the X application (i.e., client) that you want to run is located on a remote system You can arrange to have the application output display on the laptop The following paragraphs ... Machine C Now that authorization for Machine C to connect to the display on Machine A is in place, the last task is to set the DISPLAY variable for the X client on CHAPTER 21 ■ A BRIEF TOUR OF ... displayed To extract the authority information for the current display in a usable form and send it to a file called xauth-cookie_file, run the following command: xauth nextract - $DISPLAY > xauth_cookie_file...
Ngày tải lên: 05/10/2013, 08:51
Tài liệu A Brief History Of The English Language Eckersley 1960 ppt
Ngày tải lên: 25/12/2013, 13:15
Báo cáo khoa học: A structural overview of the PDI family of proteins docx
... ERp57 and the tip of the calreticulin P-domain Proc Natl Acad Sci USA 99, 1954–1959 Satoh M, Shimada A, Keino H, Kashiwai A, Nagai N, Saga S & Hosokawa M (2005) Functional characterization of thioredoxin ... orientation of the bb¢ domains and significant differences in orientation of their a and a domains The catalytic cysteines (orange) of the °C yeast PDI structure face each other (B) The b and b¢ ... helix a3 of the b¢ domain For clarity, ERp72 residues are not labeled and side chains of the ERp57–tapasin structure are not shown (C) The structures of the b¢ domains of human PDI (gray) and the...
Ngày tải lên: 15/03/2014, 23:20
A Brief History of the English Language and Literature, Vol. 2 doc
... letters of the Greek alphabet, which are called alpha, beta There are languages that have never been put upon paper at all, such as many of the African languages, many in the South Sea Islands, and ... Toddy CHAPTER V 41 HUNGARIAN Hussar Sabre Shako Tokay MALAY Amuck Bamboo Bantam Caddy Cassowary Cockatoo Dugong Gamboge Gong Gutta-percha Mandarin Mango Orang-outang Rattan Sago Upas PERSIAN Awning ... Canary Chimpanzee Gnu Gorilla Guinea Karoo Kraal Oasis Quagga Zebra AMERICAN TONGUES Alpaca Buccaneer Cacique Cannibal Canoe Caoutchouc Cayman Chocolate Condor Guano Hammock Jaguar Jalap Jerked...
Ngày tải lên: 17/03/2014, 02:20
A Brief Account of the Destruction of the Indies pdf
... of St John and Jamaica A Brief Account of the Destruction of the by Bartolome de las Casas In the Year 1509, the Spaniards sailed to the Islands of St John and Jamaica (resembling Gardensa and ... demanded of them six thousand Indians to drudge for them in the carriage of their bag and baggage; and as soon as they came the Spaniards clapt them into the Yards belonging to their Houses and there ... was inferior to that of Children of ten or twelve years of age: and this I can assure you, that the Indians had ever a just cause of raising War against the Spaniards, and the Spaniards on the...
Ngày tải lên: 17/03/2014, 13:20
Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx
... PlatiniumÒ Taq DNA High Fidelity Polymerase (Invitrogen) and the primers: PDZ-1-2, forward: 5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, and reverse: 5¢GGATCCCCATCATTCATATACATACTTGT GGGTT-3¢; PDZ3, forward: ... 5¢-GTGGGGAAATATGCTCTTGAGGAGGT-3¢; primers 2, forward: 5¢-GTGACTTCAGAGACACTGCCA-3¢, and reverse: 5¢-CCCTTTCAAGTGTGATTTCTTC3¢; primers 3, forward: 5¢-ACCAGATGGTGAGAGCGAT-3¢, and reverse: 5¢-CTGTCTTTCATAGGTCCCAAT-3¢ ... mutagenic primers were: GRRF-PDZ1: 5¢GAAAGGGGAAATTCAGGGCGTCGT TTCAGCATTGCAGGAGG-3¢; GRRF-PDZ2: 5¢-ATTA AAGGTCCTAAAGGTCGTCGGTTTAGCATTGCTGGA GG-3¢; RAAV-MEK2: 5¢-CACCCACGCGCGCCGCCGT GTGA-3¢ and...
Ngày tải lên: 22/03/2014, 16:20
A BRIEF HISTORY OF THE UNITED STATES docx
... points of American History and Biography Holmes's American Annals is invaluable, and the early volumes of the North American Review contain a great deal of interesting historical matter The American ... a grant of all the territory between the fortieth and fortysixth parallels of latitude [Footnote: Between the sites of Philadelphia and Montreal.] This tract was termed Acadia, a name afterward ... Anthony to the Gulf They had traversed a region including what is now known as Louisiana, Arkansas, Mississippi, Iowa, Minnesota, Nebraska, Kansas, the Canadas and Acadia [Footnote: As we shall see...
Ngày tải lên: 22/03/2014, 22:20
A Brief History of the Internet docx
... don't." [Nyah nyah naa naa naa!] *** *** Now that ownership of the basic library of human thoughts is potentially available to every human being on Earth I have been watching the various attempts ... of information a whole planet of human beings would generate These ideas were remarkably ahead of their time, as attested to by an Independent Plans of Study Degree in the subject of Human Machine ... with ALL of such graphics and markup proposals is LIMITED DISTRIBUTION as a way of life The purpose of each on of these is and always has been to keep knowledge in the hands of the few and away...
Ngày tải lên: 22/03/2014, 22:20
A brief sketch of the work of Matthew ppt
... the use of its laboratory In the early summer of 1861 the Secretary of the Navy, the Governor of Virginia, the chairman of the Committee of Naval Affairs, and other prominent officials were asked ... especially during the last year A brief sketch of the work of Matthew by Richard L Maury 14 of the war, that the Secretary of the American Navy, in his annual report of December, 1865, to the President ... and also a quantity of floating torpedoes, and suggests that as he has information that the Confederates have a number of "Davids" completed and in an advanced state of construction, the Department...
Ngày tải lên: 23/03/2014, 05:20
Towards a safer use of the Internet for children in the EU – a parents’ perspective ppt
... software on the computer that their child used at home, compared to only 5% of the parents in Romania and Bulgaria In Romania – and in Lithuania and Portugal – approximately six out of 10 parents ... Romania and Malta thought that their child accessed the Internet from a public place In only two countries did at least one-fifth of the parents say that their child, as far as they were aware, ... Safe Internet for children Analytical report Sources for information and advice about safer use of the Internet Family and friends were the most popular source of information or advice for parents...
Ngày tải lên: 29/03/2014, 19:20
a brief history of the paradox philosophy and the labyrinths of the mind dec 2003
... resembles the earth’s surface; a jigsaw puzzle of giant plates that slowly collide and rub against each other The stability of terra firma is the result of great forces and counterforces The equilibrium ... idea of what the answer is Neither did the creator of the Mad Hatter, the logician Lewis Carroll The poser of a paradox need not drape its meaning behind ambiguities and metaphor He can afford to ... with the unacceptable conclusion of an argument that has acceptable premises and an acceptable inference pattern J L Mackie says the paradox is the whole argument The remaining philosophers say a...
Ngày tải lên: 11/06/2014, 01:31
university of calgary press how skeptics do ethics a brief history of the late modern linguistic turn apr 2007
... indignation is a paradox A materialist has no standard of comparison for how things could be other than the way they are Logically, a materialist is a well-adjusted realist S/he has no measure for ... matters of apparent fact Add all the facts up in as great a detail as you like and you still will not reach a qualitative total that adds up to interpersonal regard and moral concern The sum of the ... knowledge of our time.”⁵⁵ Abela, Strawson, and Hacking back Kant against Hume They call Kant’s categorical theory of perception realistic They believe Kant saved the traditional capacity for moral judgment...
Ngày tải lên: 11/06/2014, 12:49
d. to stay --> b 114. A artist went to a beautiful part of the country for a holiday, and stayed pdf
... 266 A Suez Canal connects the Mediterranean Sea and the Gulf of Suez and separates the continents of Africa and Asia a A b connects c separates d of > a 267 Ships sailing in Europe to Asia once ... other person saying > b The salary of a bus driver is much higher a in comparison with the salary of a teacher b than a teacher c than that of a teacher d to compare as a teacher > c Professional ... one of the participants in a conversation wonders no real communication has taken place a what said the other person b what the other person said c what did the other person say d what was the...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo toán học: "A refinement of the formula for k-ary trees and the Gould-Vandermonde’s convolution" pps
... internal vertices and i colored leaves of the first class, we attach β leaves to its candidate leaf and erase the color of the candidate leaf (now an internal vertex) Thus we obtain a β-ary tree with ... in a very recent paper of Bajunaid et al [1, 2005] They claimed that they did not find their result in the literature and they did not know any obvious combinatorial proof for their special case, ... derived from theorems in Sprugnoli et al [5] Also we refine the formula for Cβ,γ (n) with aids of a Gould classes of inverse relation and obtain an implicit formula for the generating function of Cβ,γ...
Ngày tải lên: 07/08/2014, 15:23
báo cáo khoa học: "Implementing health research through academic and clinical partnerships: a realistic evaluation of the Collaborations for Leadership in Applied Health Research and Care (CLAHRC)" pot
... article as: Rycroft-Malone et al.: Implementing health research through academic and clinical partnerships: a realistic evaluation of the Collaborations for Leadership in Applied Health Research ... could be used for further evaluations of the sustainability of CLAHRC-like approaches Theoretical framework Implementation research has tended to lack a theoretical basis [32,55,56] and has been described ... related to a tracer issue [81] These cases represent a natural sample of the CLAHRCs as each has planned a different approach to implementation Sampling is based on a theoretical replication argument;...
Ngày tải lên: 10/08/2014, 11:20
Báo cáo y học: " Assessing medically unexplained symptoms: evaluation of a shortened version of the SOMS for use in primary care" doc
... interpretation of data, critical revisions of the manuscript All authors read and approved the final manuscript Acknowledgements We thank the clinicians and patients of "Mais Carandá" Family Health ... longitudinal assessment of the case and all data from medical records were evaluated to form a diagnosis of Clinical Somatizers (CS), taking into account the number of validated unexplained symptoms ... period all symptoms for which a medical explanation was in doubt were further discussed with the participant's GP The history of somatoform complaints was made for each subject As a standard procedure,...
Ngày tải lên: 11/08/2014, 16:22
Báo cáo y học: "Systematic review: Intra-aortic balloon counterpulsation pump therapy: a critical appraisal of the evidence for patients with acute myocardial infarction" doc
... care Intracoronary thrombolysis was used in 42% of patients later randomized to IABP therapy compared to 46% of patients in the standard therapy arm Intravenous heparin was used for a mean of ... was not broad since data for this economic analysis was only based on inhospital billings It may be argued that from an economic standpoint, the advantages or disadvantages of IABP therapy may ... reperfusion of the IRA Rescue angioplasty was not attempted in any of these patients This study randomized patients at the end of initial coronary angiography to 48 h of prophylactic IABP therapy (n...
Ngày tải lên: 12/08/2014, 18:20