a 13 combination of inline sensors with electronic and fluidic bus system

CORREGGIO A COLLECTION OF FIFTEEN PICTURES AND A SUPPOSED PORTRAIT OF THE PAINTER, WITH INTRODUCTION AND INTERPRETATION pot

CORREGGIO A COLLECTION OF FIFTEEN PICTURES AND A SUPPOSED PORTRAIT OF THE PAINTER, WITH INTRODUCTION AND INTERPRETATION pot

... the arms and hands are as delicately modelled as a woman's The face is oval, with regular features of classic mould, a short parted beard, and long hair falling in disordered curls about it This ... those of some dainty woman, and might be mated with that of Mary Magdalene It is apparent that the study of hands and feet interested our painter more than that of faces We shall lose much in ... color with which he painted flesh and drapery, the modulations of light playing over cheek and neck With hair and hands he took especial pains, and these features often redeem otherwise unattractive...

Ngày tải lên: 06/03/2014, 13:20

87 567 0
Effects of simultaneous doping with boron and phosphorous on the structural, electronic and optical properties of silicon nanostructures

Effects of simultaneous doping with boron and phosphorous on the structural, electronic and optical properties of silicon nanostructures

... B and P atoms are at the smallest possible distance (2.00 A, top ˚ panel) or at the largest possible distance (10.60 A, bottom panel) for this nanocrystal A Gaussian broadening of 0.1 eV has ... Single-doping has been investigated both in spherical and faceted-like Si-nc [13, 16] The spherical Si-nc are built taking all the bulk Si atoms contained within a sphere of a given radius and terminating ... Si nanocrystals 2.1 Single-doped Si nanocrystals We resume, here, the effects of size and shape of Si-nc on the incorporation of group-III (B and Al), group-IV (C and Ge) and group-V (N and P)...

Ngày tải lên: 16/03/2014, 15:15

8 1K 0
Báo cáo Y học: Hemocyanin from the keyhole limpet Megathura crenulata (KLH) carries a novel type of N-glycans with Gal(b1–6)Man-motifs doc

Báo cáo Y học: Hemocyanin from the keyhole limpet Megathura crenulata (KLH) carries a novel type of N-glycans with Gal(b1–6)Man-motifs doc

... oligosaccharide fractions were separately pyridylaminated and designated endoH-PA, PNGaseF-PA, PNGaseA-PA and Hyd(HFA)-PA, respectively Analytical anion-exchange HPLC of the pyridylaminated oligosaccharide ... purchased from Sigma (Deisenhofen, Germany) Peptide-N4-(N-acetyl-b-glucosaminyl)asparagine amidase A from almond (PNGase A) was from Seikagaku (Tokyo, Japan) and b-galactosidase from jack beans was ... Gal2Man3GlcNAc3PA Man2GlcNAc2PA Gal1Man2GlcNAc2PA Man6GlcNAc2PA Man2GlcNAc2FucPA Man3GlcNAc2PA Gal1Man2GlcNAc2FucPA Gal1Man3GlcNAc2PA Man3GlcNAc2FucPA Gal1Man3GlcNAc2FucPA 1133 .4 1539.7 850.2 1012.2 1498.3...

Ngày tải lên: 31/03/2014, 08:20

15 482 0
Báo cáo toán học: " General decay for a wave equation of Kirchhoff type with a boundary control of memory type" pdf

Báo cáo toán học: " General decay for a wave equation of Kirchhoff type with a boundary control of memory type" pdf

... the case where M(s) = 1, Cavalcanti et al [14] investigated the existence and uniform decay of strong solutions of wave equation (1.1) with a nonlinear boundary damping of memory type and a nonlinear ... domain with nonlinear boundary damping and memory term and M(s) = + s and f = We note that stability of problems with the nonlinear term h(∇u) requires a careful treatment because we not have any ... nonlinear wave equations of Kirchhoff type with some dissipation Nonlinear Anal TMA 65, 243–264 (2006) doi:10.1016/j.na.2004.11.023 13 Yamada, Y: On some quasilinear wave equations with dissipative...

Ngày tải lên: 20/06/2014, 21:20

15 655 0
Báo cáo hóa học: " Research Article Integral Means Inequalities for Fractional Derivatives of a Unified Subclass of Prestarlike Functions with Negative Coefficients" ppt

Báo cáo hóa học: " Research Article Integral Means Inequalities for Fractional Derivatives of a Unified Subclass of Prestarlike Functions with Negative Coefficients" ppt

... Raina and Srivastava [6] (1.12) ¨ u H O G¨ ney and S Owa We begin by recalling the following useful characterizations of the function class ᏼ(α,β,σ) due to Raina and Srivastava [6] Lemma 1.1 A ... Owa and B A Uralegaddi, A class of functions α-prestarlike of order β,” Bulletin of the Korean Mathematical Society, vol 21, no 2, pp 77–85, 1984 [5] H M Srivastava and M K Aouf, “Some applications ... 53–61, 1995 [6] R K Raina and H M Srivastava, A unified presentation of certain subclasses of prestarlike functions with negative coefficients,” Computers & Mathematics with Applications, vol 38, no...

Ngày tải lên: 22/06/2014, 18:20

9 279 0
PrefaceThe industrial brushless servomotor has developed through a remarkable combination of ppt

PrefaceThe industrial brushless servomotor has developed through a remarkable combination of ppt

... for his constant support and for the many hours of his time taken up by our discussions, and also to Van Hamlin and Omar Benzaid for their readily given advice and practical help I am also indebted ... physical appearance Both have many characteristics similar to those of a permanent magnet brushed DC motor, and both are operated from a source of direct current A review of the features of the permanent ... temperature above O0 average, winding temperature above O0 minimum, winding ripple temperature above O0 angular displacement angle of load rotation real part of Laplace operator s electrical time...

Ngày tải lên: 27/06/2014, 05:20

191 175 0
Báo cáo y học: " A Novel Population of Mesenchymal Progenitors with Hematopoietic Potential Originated from CD14- Peripheral Blood Mononuclear Cell" potx

Báo cáo y học: " A Novel Population of Mesenchymal Progenitors with Hematopoietic Potential Originated from CD14- Peripheral Blood Mononuclear Cell" potx

... CCT GTG GCA TCC ATG AAA C-3’ (Forward); 5’-TAA AAC GCA GCT CAG TAA CAG TCC G-3’ (Reverse); Collagen (Col)-I: 5’-GGA GAG TAC TGG ATC GAC CCT AAC-3’ (Forward); 5’-CTG ACC TGT CTC CAT GTT GCA-3’ (Reverse); ... USA), CD73 (BD Pharmingen, USA), rabbit pAb against CD14 (Santa cruz, USA), goat mAb against CD34 (RnD, USA), FITC-conjugated mouse mAb against CD29, CD45, CD90 and PE-conjugated mouse mAb against ... Col-III: 5’-GAA AAA ACC CTG CTC GGA ATT-3’ (Forward); 5’-GGA TCA ACC CAG TAT TCT CCA CTCT-3’ (Reverse) The PCR conditions included predenaturation at 94℃ for min, and 35 cycles of denaturation at 94℃...

Ngày tải lên: 08/08/2014, 18:20

14 351 0
báo cáo khoa học: "A rare combination of an endocrine tumour of the common bile duct and a follicular lymphoma of the ampulla of Vater: a case report and review of the literature" ppt

báo cáo khoa học: "A rare combination of an endocrine tumour of the common bile duct and a follicular lymphoma of the ampulla of Vater: a case report and review of the literature" ppt

... invasion of adjacent tissues, and vascular and perineural invasion Available data extrapolated from the existing literature suggest that carcinoid tumours of the extrahepatic biliary tree are of ... carcinoma (malignant carcinoid) of the extrahepatic biliary tract: report of two cases and literature review APMIS 2010, 118:543-556 Yoshino T, Miyake K, Ichimura K, Mannami T, Ohara N, Hamazaki ... neoplasm However, the final diagnosis revealed a follicular lymphoma of the duodenum and a carcinoid tumour of the CBD No adjuvant therapy was judged appropriate after thorough staging and the patient...

Ngày tải lên: 09/08/2014, 01:24

4 432 0
Báo cáo y học: "The discovery of potential acetylcholinesterase inhibitors: A combination of pharmacophore modeling, virtual screening, and molecular docking studies" pptx

Báo cáo y học: "The discovery of potential acetylcholinesterase inhibitors: A combination of pharmacophore modeling, virtual screening, and molecular docking studies" pptx

... pharmacophore model used as the 3D query in database searching was retained as a hit Two database searching options such as Fast/Flexible and Best/Flexible search are available in DS V2.5.5 Of these two, ... dimensional (3D) spatial arrangement and geometric parameters of Hypo1 and distance between pharmacophore features (Å) (B) Best Pharmacophore features model (C) Hypo1 mapping with one of the most active ... Division of Institute of Nuclear Energy Research CC is a research fellow in the Department of Medical Research of Mackay Memorial Hospital HYL, WT, and YH are professors from National Taiwan University,...

Ngày tải lên: 10/08/2014, 05:21

13 391 0
báo cáo khoa học:" Validation of the Excited Component of the Positive and Negative Syndrome Scale (PANSSEC) in a naturalistic sample of 278 patients with acute psychosis and agitation in a psychiatric emergency room" ppsx

báo cáo khoa học:" Validation of the Excited Component of the Positive and Negative Syndrome Scale (PANSSEC) in a naturalistic sample of 278 patients with acute psychosis and agitation in a psychiatric emergency room" ppsx

... (CGI-I) and the Agitation and Calmness Evaluation Scale (ACES), in an unselected sample of 278 patients who received oral psychopharmacological treatment according to standard clinical practice at ... has a good sensitivity; without either ceiling or floor effect; with an acceptable Cronbach’s alpha and an Page 10 of 11 optimal temporal stability The factorial analysis has revealed a unifactorial ... development of the protocol and to the collection and/ or analysis of data for this study All authors drafted and/ or critically read and revised the manuscript for important intellectual content and have...

Ngày tải lên: 12/08/2014, 01:22

11 423 0
Báo cáo y học: " Detection of porcine parvovirus using a taqman-based real-time pcr with primers and probe designed for the NS1 gene" doc

Báo cáo y học: " Detection of porcine parvovirus using a taqman-based real-time pcr with primers and probe designed for the NS1 gene" doc

... primers and probe were: NS1-FP (forward primer): 5’-GAAGACTGGATGATGACAGATCCA-3’, NS1-RP (reverse primer): 5’-TGCTGTTTTTGTTCT TGCTAGAGTAA-3’ NS1-P (probe): FAM-AATGATGGCTCAAACCGGAGGAGA-BHQ1 The ... was labeled with 6carboxyfluorescein (FAM) at the 5’-end and with BHQ1 at the 3’-end Preparation of standard plasmid DNA PCR amplification of the NS1 gene was carried out in a reaction mix of ... authors read and approved the final manuscript Author details Laboratory of Marine Genetics and Breeding (MGB), Ocean University of China, Qingdao 266003, China 2China Animal Health and Epidemiology...

Ngày tải lên: 12/08/2014, 02:20

4 589 0
báo cáo khoa học: " A compatible interaction of Alternaria brassicicola with Arabidopsis thaliana ecotype DiG: evidence for a specific transcriptional signature" pdf

báo cáo khoa học: " A compatible interaction of Alternaria brassicicola with Arabidopsis thaliana ecotype DiG: evidence for a specific transcriptional signature" pdf

... CCTTGAGACTCTCTGTAGTATTCACC GATTGAGCTTCTTCTGCTGAGCATC CCAAGCTGATACACTTCCTCTGC CAAGCAGAGAACTCAACACACCAGAG CACAAACCGGGTACTCGTGAG CATCAATGGTGAATGCCTGTCC CTGCACCGAAAGCCCGAGTAATC TAGATTCTCGTAATCTCAGCTCT CAGCGCTTTGAGATTATAGGGTCC ... CGATTGTGCACCAGCCTCATTGGTT CGTTGTGGCTCTTTACAAACAACAAAAC CGGTGGTACTCCTCCTGGACCCACCGGC GACAACAATGCGGTCGTCAAGG ATGGCAAATATCTCCAGTATTCACA GCTAAGTTTGCTTCCATCATCACCCTT TGCAGCTCGCATAAGCGTTGTGACTGGTA GATGTTGATGAATTGGAGAGGAGGATG ... GTATGCGACGCCCTCAAGGATG GCTGATCTCAGGTCATCCATCTG GGAAAACTGCAGAGCTAAAGGTGG GACCACAACGAGAGTATCTCCGTC GTGAGAGAAGGACTAGCCTACGGTAC GATGAAAACCGCTCTTGACAAATG GTTTGCTTGTCGTGCGGTGAGAG TCGTCTTTGTAGCTCTTGTAGGTG...

Ngày tải lên: 12/08/2014, 03:20

11 199 0
Báo cáo y học: "The likelihood of persistent arthritis increases with the level of anti-citrullinated peptide antibody and immunoglobulin M rheumatoid factor: a longitudinal study of 376 patients with very early undifferentiated arthritis" doc

Báo cáo y học: "The likelihood of persistent arthritis increases with the level of anti-citrullinated peptide antibody and immunoglobulin M rheumatoid factor: a longitudinal study of 376 patients with very early undifferentiated arthritis" doc

... information about anti-CCP and IgM RF was available in 483/572 (84%) patients enrolled in the study Patients with and without available sera were similar regarding baseline characteristics and ... persistent arthritis Statistical analysis Means and standard deviations were calculated for continuous variables following a Gaussian distribution, otherwise median values and inter quartile ranges ... Serum was frozen at baseline and stored at -70°C and used to analyse anti-citrullinated protein antibodies (ACPA) (anti-CCP2, INOVA Diagnostics, Inc.® San Diego, CA, USA) and IgM rheumatoid factor...

Ngày tải lên: 12/08/2014, 12:20

9 260 0
Báo cáo y học: "Timing of adequate antibiotic therapy is a greater determinant of outcome than are TNF and IL-10 polymorphisms in patients with sepsis." potx

Báo cáo y học: "Timing of adequate antibiotic therapy is a greater determinant of outcome than are TNF and IL-10 polymorphisms in patients with sepsis." potx

... dose and pattern of administration were in accordance with current standards Failure of organs was evaluated using the Sequential Organ Failure Assessment (SOFA) scale on admission and during ... of an increase in SOFA score was delayed initiation of adequate antibiotic therapy (P < 0.05) pital in patients with sepsis Timely adequate antibiotic administration is associated with decreased ... inflammatory response, the greater the mortality rate antibiotic therapy Correlation between delta-SOFA and delayed initiation of adequate antibiotic therapy SOFA, Sequential Organ Failure Assessment...

Ngày tải lên: 13/08/2014, 01:20

12 294 0
Báo cáo y học: "Tracheobronchopathia osteochondroplastica: A rare cause of chronic cough with haemoptysis" pptx

Báo cáo y học: "Tracheobronchopathia osteochondroplastica: A rare cause of chronic cough with haemoptysis" pptx

... (1), new cartilage Bronchial cartilage with abnormal tracheobronchopathia Bronchial cartilage with abnormal and unevenly distributed mineralization leads the diagnosis tracheobronchopathia osteochondroplastica: ... Tracheobronchopathia osteochondroplastica Respirology 2000, 5:377-380 Jabbardarjani HR, Radpey B, Kharabian S, Masjedi MR: Tracheobronchopathia osteochondroplastica: Presentation of ten cases and ... examination revealed bronchial cartilage and lamellar bone with little marrow (Fig 2), a clear evidence for TPO The mucous membrane of the trachea was lumpy, stiff and bled easily Secretion was...

Ngày tải lên: 13/08/2014, 08:20

4 247 0
Báo cáo y học: "Effects of plasma expansion with albumin and paracentesis on haemodynamics and kidney function in critically ill cirrhotic patients with tense ascites and hepatorenal syndrome: a prospective uncontrolled trial" ppt

Báo cáo y học: "Effects of plasma expansion with albumin and paracentesis on haemodynamics and kidney function in critically ill cirrhotic patients with tense ascites and hepatorenal syndrome: a prospective uncontrolled trial" ppt

... 94:1493-1502 Garcia-Compean D, Zacarias Villarreal J, Bahena Cuevas H, Garcia Cantu DA, Estrella M, Garza Tamez E, Valadez Castillo R, Barragan RF: Total therapeutic paracentesis (TTP) with and without ... triplicate and averaged They were performed at 12-hour intervals and immediately before and after the infusion of a fluid load and before and after paracentesis Intra-abdominal pressure was measured ... Because the concomitant decrease in MAP was small, this resulted in a major increase in APP and Table Time course of haemodynamic parameters and parameters of kidney function Parameter Before paracentesis...

Ngày tải lên: 13/08/2014, 08:21

9 568 0
Báo cáo y học: "A novel combination of Chinese medicines to treat advanced cancers and lymphomas in rats" ppt

Báo cáo y học: "A novel combination of Chinese medicines to treat advanced cancers and lymphomas in rats" ppt

... was measured according to the method by Geng et al [29] Statistical analysis Quantitative data were expressed as mean ± SD (standard deviation) and analyzed by one way analysis of variances (ANOVA) ... reactive and cause damage to part of cells by inducing DNA strand breaks, purine oxidation and protein DNA cross linking and cell membrane damage [11] Accumulation of such damage may cause cell death ... http://www.cmjournal.org/content/4/1/23 animal care guidelines and the ethics committee of the institution Chemicals Analytical-grade TCE was purchased from El-Nasr Pharmaceutical Chemical (Egypt) All other chemicals and bio-chemicals...

Ngày tải lên: 13/08/2014, 15:21

6 337 0
w